WebAssembly
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...
... 57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...
... 57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...
...And 8 more matches

clip-path - CSS: Cascading Style Sheets
> <div class="row"> <div class="cell"> <span>html</span> <div class="container"> <p class="none"> i love<br><em>clipping</em> </p> </div> </div> <div class="cell"> <span>svg</span> <div class="container viewbox"> <svg viewbox="0 0 192 192"> <g class="none"> <rect x="24" y="24" width="144" height="144" /> <text x="96" y="91">i love</text> <text x="96" y="109" class="em">clipping</text> </g> </svg> </div> </div> </div> <div class="note">clip-path: url(#mypath)<br><br> assuming the following clippath definition: <pre> &lt;svg&gt; &lt;clippath id="mypath" clippathunits="objectboundingbox"&gt; &...
...iv> <div class="row"> <div class="cell"> <span>html</span> <div class="container"> <p class="svg"> i love<br><em>clipping</em> </p> </div> </div> <div class="cell"> <span>svg</span> <div class="container viewbox"> <svg viewbox="0 0 192 192"> <g class="svg"> <rect x="24" y="24" width="144" height="144" /> <text x="96" y="91">i love</text> <text x="96" y="109" class="em">clipping</text> </g> </svg> </div> </div> </div> <div class="note">clip-path: path('m15,45 a30,30,0,0,1,75,45 a30,30,0,0,1,135,45 q135,90,75,130 q15,90,15,45 z') </div> <div class="row"> <div class="cell"> <span>html</span> ...
... <div class="container"> <p class="svg2"> i love<br><em>clipping</em> </p> </div> </div> <div class="cell"> <span>svg</span> <div class="container viewbox"> <svg viewbox="0 0 192 192"> <g class="svg2"> <rect x="24" y="24" width="144" height="144" /> <text x="96" y="91">i love</text> <text x="96" y="109" class="em">clipping</text> </g> </svg> </div> </div> </div> <div class="note">clip-path: circle(25%)</div> <div class="row"> <div class="cell"> <span>html</span> <div class="container"> <p class="shape1"> i love<br><em>clipping</em> </p> </div> </div> <d...
...And 7 more matches

Table Layout Regression Tests - Archive of obsolete content
a typical beginning of a dump (*.rgd file) looks like: <frame va="15022440" type="viewport(-1)" state="270340" parent="0"> <view va="47171904"> </view> <stylecontext va="15022232"> <font serif 240 240 0 /> <color data="-16777216"/> <background data="0 2 3 -1 0 0 "/> <spacing data="left: null top: null right: null bottom: null left: null top: null right: null bottom: null left: 1[0x1]enum top: 1[0x1]enum right: 1[0x1]enum bottom: 1[0x1]enum lef...
...0,26437,4872,600 node 1: tableouter(table)(144) 0x10004 0,26437,4824,600, |null attr|-16777216|left: 0[0x0]tw top: 0[0x0]tw right: 0[0x0]tw bottom: 0[0x0]tw left: 0[0x0]tw top: 0[0x0]tw right: 0[0x0]tw bottom: 0[0x0]tw left: 1[0x1]enum top: 1[0x1]enum right: 1[0x1]enum bottom: 1[0x1]enum left: null top: null right: null bottom: null left: null top: null right: null bottom: null 1[0x1]enum 0|1 1 [none]|left: auto top: auto right: auto bot...
...tom: auto auto 0[0x0]tw null auto 0[0x0]tw null 0 auto |0 0 0 normal normal 0[0x0]tw normal |0 8 1,000000 0 0 0 0 0 0 0 0 0 0 0 [none]|0 0 0 -1 1 |0 0 0 null node 2: tableouter(table)(144) 0x10004 0,26437,4872,600, |null attr|-16777216|left: 0[0x0]tw top: 0[0x0]tw right: 0[0x0]tw bottom: 0[0x0]tw left: 0[0x0]tw top: 0[0x0]tw right: 0[0x0]tw bottom: 0[0x0]tw left: 1[0x1]enum top: 1[0x1]enum right: 1[0x1]enum bottom: 1[0x1]enum left: null top: null right: null bottom: null left: null top: null right: null bottom: null 1[0x1]enum 0|1 1 [none]|left: auto top: auto right: auto bottom: auto auto 0[0x0]tw null auto 0[0x0]tw null 0 auto |0 0 0 normal normal 0[0x0]tw normal |0 8 1,000000 0 0 0 0 0 0 0 0 0 0 0 [none]|0 0 0 -1 1 |0 0 0 null frame bbox mismatch: 0,0,4824,6...
...And 6 more matches

Basic concepts behind Web Audio API - Web APIs
let's look at a mono and a stereo audio buffer, each is one second long, and playing at 44100hz: the mono buffer will have 44100 samples, and 44100 frames.
... the length property will be 44100.
... the stereo buffer will have 88200 samples, but still 44100 frames.
...And 6 more matches

NotificationEvent - Web APIs
desktopmobilechromeedgefirefoxinternet exploreroperasafariandroid webviewchrome for androidfirefox for androidopera for androidsafari on iossamsung internetnotificationevent experimentalchrome full support 42edge full support ≤18firefox full support 44notes full support 44notes notes extended support releases (esr) before firefox 78 esr do not support service workers and the push api.ie ?
... webview android no support nochrome android full support 42firefox android full support 44opera android full support 37safari ios ?
... samsung internet android full support 4.0notificationevent() constructor experimentalchrome full support 42edge full support ≤18firefox full support 44notes full support 44notes notes extended support releases (esr) before firefox 78 esr do not support service workers and the push api.ie ?
...And 5 more matches

NSS tools : ssltab
the following are well-known port numbers: * http 80 * https 443 * smtp 25 * ftp 21 * imap 143 * imaps 993 (imap over ssl) * nntp 119 * nntps 563 (nntp over ssl) usage and examples you can use the ssl debugging tool to intercept any connection information.
...example 1 $ ssltap.exe -sx -p 444 interzone.mcom.com:443 > sx.txt output connected to interzone.mcom.com:443 -->; [ alloclen = 66 bytes [ssl2] clienthellov2 { version = {0x03, 0x00} cipher-specs-length = 39 (0x27) sid-length = 0 (0x00) challenge-length = 16 (0x10) cipher-suites = { (0x010080) ssl2/rsa/rc4-128/md5 (0x020080) ssl2/rsa/rc4-40/md5 (0x030080) ssl2/rsa/rc2cbc128/md5 (0x040080) ssl2/rsa/rc2cbc40/md5 (0x060040) ssl2/rsa...
...type = 14 (server_hello_done) length = 0 (0x000000) } } ] --> [ sslrecord { 0: 16 03 00 00 44 |....d type = 22 (handshake) version = { 3,0 } length = 68 (0x44) handshake { 0: 10 00 00 40 |...@ type = 16 (client_key_exchange) length = 64 (0x000040) clientkeyexchange { message = {...} } } } ] --> [ sslrecord { 0: 14 03 00 00 01 |.....
...And 4 more matches

NSS tools : ssltap
the following are well-known port numbers: * http 80 * https 443 * smtp 25 * ftp 21 * imap 143 * imaps 993 (imap over ssl) * nntp 119 * nntps 563 (nntp over ssl) usage and examples you can use the ssl debugging tool to intercept any connection information.
...example 1 $ ssltap.exe -sx -p 444 interzone.mcom.com:443 > sx.txt output connected to interzone.mcom.com:443 -->; [ alloclen = 66 bytes [ssl2] clienthellov2 { version = {0x03, 0x00} cipher-specs-length = 39 (0x27) sid-length = 0 (0x00) challenge-length = 16 (0x10) cipher-suites = { (0x010080) ssl2/rsa/rc4-128/md5 (0x020080) ssl2/rsa/rc4-40/md5 (0x030080) ssl2/rsa/rc2cbc128/md5 (0x040080) ssl2/rsa/rc2cbc40/md5 (0x060040) ssl2/rsa...
...type = 14 (server_hello_done) length = 0 (0x000000) } } ] --> [ sslrecord { 0: 16 03 00 00 44 |....d type = 22 (handshake) version = { 3,0 } length = 68 (0x44) handshake { 0: 10 00 00 40 |...@ type = 16 (client_key_exchange) length = 64 (0x000040) clientkeyexchange { message = {...} } } } ] --> [ sslrecord { 0: 14 03 00 00 01 |.....
...And 4 more matches

NSS Tools ssltap
the following are well-known port numbers: http 80 https 443 smtp 25 ftp 21 imap 143 imaps 993 (imap over ssl) nntp 119 nntps 563 (nntp over ssl) examples you can use the ssl debugging tool to intercept any connection information.
... command ssltap.exe -sx -p 444 interzone.mcom.com:443 > sx.txt output output connected to interzone.mcom.com:443--> [alloclen = 66 bytes [ssl2] clienthellov2 { version = {0x03, 0x00} cipher-specs-length = 39 (0x27) sid-length = 0 (0x00) challenge-length = 16 (0x10) cipher-suites = { (0x010080) ssl2/rsa/rc4-128/md5 (0x020080) ssl2/r...
... type = 14 (server_hello_done) length = 0 (0x000000) }}]--> [sslrecord { 0: 16 03 00 00 44 |....d type = 22 (handshake) version = { 3,0 } length = 68 (0x44) handshake { 0: 10 00 00 40 |...@ type = 16 (client_key_exchange) length = 64 (0x000040) clientkeyexchange { message = {...} } }}]--> [sslrecord { 0: 14 03 00 00 01 |.....
...And 4 more matches

NSS tools : ssltap
the following are well-known port numbers: * http 80 * https 443 * smtp 25 * ftp 21 * imap 143 * imaps 993 (imap over ssl) * nntp 119 * nntps 563 (nntp over ssl) usage and examples you can use the ssl debugging tool to intercept any connection information.
... example 1 $ ssltap.exe -sx -p 444 interzone.mcom.com:443 > sx.txt output connected to interzone.mcom.com:443 -->; [ alloclen = 66 bytes [ssl2] clienthellov2 { version = {0x03, 0x00} cipher-specs-length = 39 (0x27) sid-length = 0 (0x00) challenge-length = 16 (0x10) cipher-suites = { (0x010080) ssl2/rsa/rc4-128/md5 (0...
... type = 14 (server_hello_done) length = 0 (0x000000) } } ] --> [ sslrecord { 0: 16 03 00 00 44 |....d type = 22 (handshake) version = { 3,0 } length = 68 (0x44) handshake { 0: 10 00 00 40 |...@ type = 16 (client_key_exchange) length = 64 (0x000040) clientkeyexchange { message = {...} } } } ] --> [ sslrecord { 0: 14 03 00 00 01 ...
...And 4 more matches

Using IndexedDB - Web APIs
const customerdata = [ { ssn: "444-44-4444", name: "bill", age: 35, email: "bill@company.com" }, { ssn: "555-55-5555", name: "donna", age: 32, email: "donna@home.org" } ]; of course, you wouldn't use someone's social security number as the primary key to a customer table because not everyone has a social security number, and you would store their birth date instead of their age, but let's ignore those unfortunate choices for ...
... removing data from the database removing data is very similar: var request = db.transaction(["customers"], "readwrite") .objectstore("customers") .delete("444-44-4444"); request.onsuccess = function(event) { // it's gone!
...you need to provide the key to retrieve the value, like so: var transaction = db.transaction(["customers"]); var objectstore = transaction.objectstore("customers"); var request = objectstore.get("444-44-4444"); request.onerror = function(event) { // handle errors!
...And 4 more matches

SubtleCrypto.unwrapKey() - Web APIs
*/ const wrappedkeybytes = [171,223,14,36,201,233,233,120,164,68,217,192,226,80, 224,39,199,235,239,60,212,169,100,23,61,54,244,197,160,80,109,230,207, 225,57,197,175,71,80,209]; /* convert an array of byte values to an arraybuffer.
...*/ const wrappedkeybytes = [6,155,182,208,7,141,44,18,3,151,58,126,68,100,252, 225,241,11,25,201,153,171,102,174,150,29,62,195,110,138,106,109,14,6,108, 148,104,221,22,93,102,221,146,25,65,112,4,140,79,194,164,163,156,250,108, 11,14,220,78,194,161,17,14,57,121,70,13,28,220,210,78,32,46,217,36,165,220, 170,244,152,214,150,83,2,138,128,11,251,227,213,72,100,158,10,162,40,195, 60,248,77,37,156,34,10,213,171,67,147,73,231,31,63,80,176,103,2...
... 27,66,150,76,242,76,102,174,179,163,184,205,11,161,224,19,110,34,175,192, 101,117,169,86,66,56,241,128,13,156,165,125,139,110,138,50,108,129,251,137, 26,186,110,117,113,207,179,59,213,18,175,14,203,192,2,97,131,125,167,227, 182,87,72,123,54,156,60,195,88,224,96,46,126,245,251,247,147,110,147,173, 82,106,93,210,55,71,127,133,41,37,181,17,106,16,158,220,136,43,75,133,96, 240,151,116,40,44,254,2,32,74,226,193,172,48,211,71,109,163,143,30,92,28, 30,183,25,16,176,207,77,93,139,242,114,91,218,126,123,234,18,9,245,53,46, 172,215,62,92,249,191,17,27,0,58,151,33,23,169,93,177,253,152,147,198,196, 226,42,202,166,99,250,127,40,221,196,121,195,198,235,30,159,159,95,182,107, 175,137,177,49,72,63,131,162,198,186,22,255,230,237,195,56,147,177,101,52, 227,125,32,180,242,47,92,212,6,14...
...And 4 more matches

Debugging Frame Reflow
log file analysis the log file for a simple table like <!doctype html public "-//w3c//dtd html 4.01 transitional//en"> <html> <head> <meta http-equiv="content-type" content="text/html; charset=iso-8859-1"> </head> <body> <table width="100"> <tbody> <tr> <td>foo</td> </tr> </tbody> </table> </body> </html> will create the following log: vp 00b97c30 r=0 a=9180,4470 c=9180,4470 cnt=856 scroll 00b97ee0 r=0 a=9180,4470 c=9180,4470 cnt=857 scroll 00b97ee0 r=0 a=9180,4470 c=9180,4470 cnt=858 canvas 00b97c6c r=0 a=9180,uc c=9180,4470 cnt=859 area 02d7afe4 r=0 a=9180,uc c=9180,uc cnt=860 text 02d7b150 r=0 a=9180,uc c=uc,uc cnt=861 text 02d7b150 d=0,0 block 02d7b210 r=0 a=9180,uc c=8940,uc cnt=862 block 02d7b210 d=8940,0 area 02d7afe4 d=...
...9180,120 canvas 00b97c6c d=9180,4470 scroll 00b97ee0 d=9180,4470 scroll 00b97ee0 d=9180,4470 vp 00b97c30 d=9180,4470 vp 00b97c30 r=1 a=9180,4470 c=9180,4470 cnt=863 scroll 00b97ee0 r=1 a=9180,4470 c=9180,4470 cnt=864 scroll 00b97ee0 r=1 a=9180,4470 c=9180,4470 cnt=865 canvas 00b97c6c r=1 a=9180,uc c=9180,4470 cnt=866 area 02d7afe4 r=1 a=9180,uc c=9180,uc cnt=867 block 02d7b210 r=1 a=9180,uc c=8940,uc cnt=868 text 02d7b3f8 r=0 a=8940,uc c=uc,uc cnt=869 text 02d7b3f8 d=0,0 tblo 02d7b5f0 r=0 a=8940,uc c=0,0 cnt=870 tbl 02d7b7ec r=0 a=8940,uc c=1500,uc cnt=871 rowg 00b984a4 r=0 a=uc,uc c=uc,uc cnt=872 row 02d7baf8 r=0 a=uc,uc c=uc,uc cnt=873 cell 02d7bc98 r=0 a=uc,uc c=uc,uc cnt=874 block 02d7bcf8 r=0 a=uc,uc c=uc,uc cnt=875 ...
...,300 me=300 cell 02d7bc98 d=330,330 me=330 row 02d7baf8 d=uc,330 rowg 00b984a4 d=uc,330 colg 02d7bfb0 r=0 a=uc,uc c=uc,uc cnt=877 col 02d7c0d8 r=0 a=0,0 c=1500,uc cnt=878 col 02d7c0d8 d=0,0 colg 02d7bfb0 d=0,0 rowg 00b984a4 r=2 a=1500,uc c=1500,uc cnt=879 row 02d7baf8 r=2 a=1500,uc c=1500,uc cnt=880 cell 02d7bc98 r=2 a=1440,uc c=1410,uc cnt=881 block 02d7bcf8 r=2 a=1410,uc c=1410,uc cnt=882 block 02d7bcf8 d=1410,300 cell 02d7bc98 d=1440,330 row 02d7baf8 d=1500,330 rowg 00b984a4 d=1500,330 colg 02d7bfb0 r=2 a=1500,uc c=1500,uc cnt=883 col 02d7c0d8 r=0 a=0,0 c=1500,uc cnt=884 col 02d7c0d8 d=0,0 colg 02d7bfb0 d=0,0 tbl 02d7b7ec d=1500,390 ...
...And 3 more matches

MathML Demo: <mtable> - tables and matrices
1 22 333 4444 x 55555 666666 a b c 7777777 11 ...--- , cols arg is "|r|c|l|", \hline's above and below.
... 1 22 333 4444 x 55555 lim n→∞ f-1 ⋃ i=1 n ai rowspan=2 here xn + yn n columnspan=2 here 7777777 11 ...--- , columnlines="solid", rowlines="dashed solid dashed".
... 1 22 333 4444 55555 x + 1 666666 a b c 7777777 11 cols arg is"r|c:l".
...And 3 more matches

NSS_3.12_release_notes.html
bug 354403: nsslist_createiterator returns pointer to a freed memory if the function fails to allocate a lock bug 399236: pkix wrapper must print debug output into stderr bug 399300: pkix error results not freed after use.
...bug 429388: vfychain.main leaks memory bug 396044: warning: usage of uninitialized variable in ckfw/object.c(174) bug 396045: warning: usage of uninitialized variable in ckfw/mechanism.c(719) bug 401986: mac os x leopard build failure in legacydb bug 325805: diff considers mozilla/security/nss/cmd/pk11util/scripts/pkey a binary file bug 385151: remove the link time dependency from nss to softoken bug 387892: add entrust root ca certificate(s) to nss bug 433386: when system clock is off by more than two days, oscp check fails, can result in crash if user tries to view certificate [[@ secitem_compareitem_util] [[@ memcmp] bug 396256: certutil and pp do not print all the generalnames in a crldp extensi...
...nsions newly supported in libpkix must be marked supported bug 331096: nss softoken must detect forks on all unix-ish platforms bug 390710: certnameconstraintstemplate is incorrect bug 416928: der decode error on this policy extension bug 375019: cache-enable pkix_ocspchecker_check bug 391454: libpkix does not honor nss's override trust flags bug 403682: cert_pkixverifycert never succeeds bug 324744: add generation of policy extensions to certutil bug 390973: add long option names to secu_parsecommandline bug 161326: need api to convert dotted oid format to/from octet representation bug 376737: cert_importcerts routinely sets valid_peer or valid_ca override trust flags bug 390381: libpkix rejects cert chain when root ca cert has no basic constraints bug 391183: rename libpkix error string nu...
...And 3 more matches

NSS_3.12.3_release_notes.html
bug 426413: audit messages need distinct types bug 438870: free freebl hashing code of dependencies on nspr and libutil bug 439115: db merge allows nickname conflicts in merged db bug 439199: sse2 instructions for bignum are not implemented on windows 32-bit bug 441321: tolerate incorrect encoding of dsa signatures in ssl 3.0 handshakes bug 444404: libpkix reports unknown issuer for nearly all certificate errors bug 452391: certutil -k incorrectly reports ec private key as an orphan bug 453234: support for seed cipher suites to tls rfc4010 bug 453364: improve pk11_cipherop error reporting (was: pk11_createcontextbysymkey returns null bug 456406: s...
... bug 464406: fix signtool regressions bug 465270: uninitialised value in devutil.c::create_object() bug 465273: dead assignment in devutil.c::nssslotarray_clone() bug 465926: during import of pkcs #12 files bug 466180: ssl_configmpserversidcache with default parameters fails on {net bug 466194: cert_decodetruststring should take a const char * input trusts string.
...ix/pkix_pl_nss/system/pkix_pl_object.c bug 466745: random number generator fails on windows ce bug 467298: sql db code uses local cache on local file system bug 468279: softoken crash importing email cert into newly upgraded db bug 468532: trusted ca trust flags not being honored in cert_verifycert bug 469583: coverity: uninitialized variable used in sec_pkcs5createalgorithmid bug 469944: when built with microsoft compilers bug 470351: crlutil build fails on windows because it calls undeclared isatty bug 471539: stop honoring digital signatures in certificates and crls based on weak hashes bug 471665: nss reports incorrect sizes for (aes) symmetric keys bug 471715: add cert to nssckbi to override rogue md5-collision ca cert bug 472291: crash in libpkix object leak tests...
...And 3 more matches

WebAssembly.Table - JavaScript
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...
... 57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...
... 57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...
...And 3 more matches

reftest opportunities files - Archive of obsolete content
parser/tests/html/bug8771.html parser/htmlparser/tests/html/bug8738.html parser/htmlparser/tests/html/bug8681.html parser/htmlparser/tests/html/bug8080.html parser/htmlparser/tests/html/bug8056.html parser/htmlparser/tests/html/bug7889.html parser/htmlparser/tests/html/bug7823.html parser/htmlparser/tests/html/bug7724.html parser/htmlparser/tests/html/bug7723.html parser/htmlparser/tests/html/bug7447.html parser/htmlparser/tests/html/bug6925.html parser/htmlparser/tests/html/bug6233.html parser/htmlparser/tests/html/bug5859.html parser/htmlparser/tests/html/bug4956.html parser/htmlparser/tests/html/bug4825.html parser/htmlparser/tests/html/bug4814.html parser/htmlparser/tests/html/bug4809.html parser/htmlparser/tests/html/bug466.html parser/htmlparser/tests/html/bug3073.html parser/htmlparse...
...r/tests/html/bug256731.html parser/htmlparser/tests/html/bug2447.html parser/htmlparser/tests/html/bug2419.html parser/htmlparser/tests/html/bug24003.html parser/htmlparser/tests/html/bug23831.html parser/htmlparser/tests/html/bug23780.html parser/htmlparser/tests/html/bug23680.html parser/htmlparser/tests/html/bug23529.html parser/htmlparser/tests/html/bug22157.html parser/htmlparser/tests/html/bug22142.html parser/htmlparser/tests/html/bug22025.html parser/htmlparser/tests/html/bug21779.html parser/htmlparser/tests/html/bug21692.html parser/htmlparser/tests/html/bug21689.html parser/htmlparser/tests/html/bug21424.html parser/htmlparser/tests/html/bug21318.html parser/htmlparser/tests/html/bug21186.html parser/htmlparser/tests/html/bug20199.html parser/htmlparser/tests/html/bug20178.html pa...
....html parser/htmlparser/tests/html/bug1220.html parser/htmlparser/tests/html/bug1203.html parser/htmlparser/tests/html/96130.html parser/htmlparser/tests/html/94208.html parser/htmlparser/tests/html/93365.html parser/htmlparser/tests/html/92530.html parser/htmlparser/tests/html/91051.html parser/htmlparser/tests/html/88992.html parser/htmlparser/tests/html/88746.html parser/htmlparser/tests/html/84491.html parser/htmlparser/tests/html/84000.html parser/htmlparser/tests/html/79492.html parser/htmlparser/tests/html/78848.html parser/htmlparser/tests/html/78444.html parser/htmlparser/tests/html/77746.html parser/htmlparser/tests/html/77352.html parser/htmlparser/tests/html/70148.html parser/htmlparser/tests/html/69576.html parser/htmlparser/tests/html/67874.html parser/htmlparser/tests/html/675...
...And 2 more matches

Using the Right Markup to Invoke Plugins - Archive of obsolete content
here's an example of this kind of usage for ie: <!-- ie only code --> <object classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" codebase="http://download.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#version=5,0,0,0" width="366" height="142" id="myflash"> <param name="movie" value="javascript-to-flash.swf" /> <param name="quality" value="high" /> <param name="swliveconnect" value="true" /> </object> in the above example, the classid attribute that goes along with the object element points to...
...thus, in the following example, instead of stopping at the activex control, ie will display the same animation twice since it also understands the mime type for flash: <!-- usage will not work as intended --> <object classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" codebase="http://download.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#version=5,0,0,0" width="366" height="142" id="myflash"> <param name="movie" value="javascript-to-flash.swf" /> <param name="quality" value="high" /> <param name="swliveconnect" value="true" /> <object type="application/x-shockwave-flash" data="javascript-to-flash.swf" width="366" height="142" ...
...here is an example of some javascript which does this: if (window.activexobject) { // browser supports activex // create object element with // download url for ie ocx document.write('<object classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000"'); document.write(' codebase="http://download.macromedia.com'); document.write('/pub/shockwave/cabs/flash/swflash.cab#version=5,0,0,0"'); document.write(' width="366" height="142" id="myflash">'); document.write(' <param name="movie" value="javascript-to-flash.swf" />'); document.write(' <param name="quality" value="high" />'); document.write(' <param name="swliveconnect" value="true" ...
...And 2 more matches

KeyboardEvent: code values - Web APIs
ft" "altleft" 0x0039 "space" "space" 0x003a "capslock" "capslock" 0x003b "f1" "f1" 0x003c "f2" "f2" 0x003d "f3" "f3" 0x003e "f4" "f4" 0x003f "f5" "f5" 0x0040 "f6" "f6" 0x0041 "f7" "f7" 0x0042 "f8" "f8" 0x0043 "f9" "f9" 0x0044 "f10" "f10" 0x0045 "pause" "pause" 0x0046 "scrolllock" "scrolllock" 0x0047 "numpad7" "numpad7" 0x0048 "numpad8" "numpad8" 0x0049 "numpad9" "numpad9" 0x004a "numpadsubtract" "numpadsubtract" 0x004b "numpad4" "numpad4" 0x004c "numpad5" "numpad5" 0x004d "numpad6" ...
... "browserhome" 0xe033, 0xe034 "unidentified" "" 0xe035 "numpaddivide" "numpaddivide" 0xe036 "unidentified" "" 0xe037 "printscreen" "printscreen" 0xe038 "altright" "altright" 0xe039, 0xe03a "unidentified" "" 0xe03b "unidentified" "help" 0xe03c～ 0xe044 "unidentified" "" 0xe045 "numlock" "numlock" 0xe046 (ctrl + pause) "pause" "pause" 0xe047 "home" "home" 0xe048 "arrowup" "arrowup" 0xe049 "pageup" "pageup" 0xe04a "unidentified" "" 0xe04b "arrowleft" "arrowleft" 0xe04c "unidentified" "" ...
... scancode (hardware_keycode) gecko chromium (44) 0x0009 "escape" "escape" 0x000a "digit1" "digit1" 0x000b "digit2" "digit2" 0x000c "digit3" "digit3" 0x000d "digit4" "digit4" 0x000e "digit5" "digit5" 0x000f "digit6" "digit6" 0x0010 "digit7" "digit7" 0x0011 "digit8" "digit8" 0x0012 "digit9" "di...
...And 2 more matches

PushEvent - Web APIs
full support 17firefox full support 44notes full support 44notes notes extended support releases (esr) before firefox 78 esr do not support service workers and the push api.ie no support noopera full support 37safari no support nowebview android ...
... no support nochrome android full support 42firefox android full support 44 full support 44 full support 48notes notes push enabled by default.opera android full support 37safari ios no support nosamsung internet android full support 4.0pushevent() constructor experimentalchrome full support 42edge full support 16disabled full support ...
... full support 17firefox full support 44notes full support 44notes notes extended support releases (esr) before firefox 78 esr do not support service workers and the push api.ie no support noopera full support 37safari no support nowebview android no support nochrome android full support 42firefox android fu...
...And 2 more matches

Example and tutorial: Simple synth keyboard - Web APIs
() { let notefreq = []; for (let i=0; i< 9; i++) { notefreq[i] = []; } notefreq[0]["a"] = 27.500000000000000; notefreq[0]["a#"] = 29.135235094880619; notefreq[0]["b"] = 30.867706328507756; notefreq[1]["c"] = 32.703195662574829; notefreq[1]["c#"] = 34.647828872109012; notefreq[1]["d"] = 36.708095989675945; notefreq[1]["d#"] = 38.890872965260113; notefreq[1]["e"] = 41.203444614108741; notefreq[1]["f"] = 43.653528929125485; notefreq[1]["f#"] = 46.249302838954299; notefreq[1]["g"] = 48.999429497718661; notefreq[1]["g#"] = 51.913087197493142; notefreq[1]["a"] = 55.000000000000000; notefreq[1]["a#"] = 58.270470189761239; notefreq[1]["b"] = 61.735412657015513; ...
... notefreq[2]["c"] = 65.406391325149658; notefreq[2]["c#"] = 69.295657744218024; notefreq[2]["d"] = 73.416191979351890; notefreq[2]["d#"] = 77.781745930520227; notefreq[2]["e"] = 82.406889228217482; notefreq[2]["f"] = 87.307057858250971; notefreq[2]["f#"] = 92.498605677908599; notefreq[2]["g"] = 97.998858995437323; notefreq[2]["g#"] = 103.826174394986284; notefreq[2]["a"] = 110.000000000000000; notefreq[2]["a#"] = 116.540940379522479; notefreq[2]["b"] = 123.470825314031027; notefreq[3]["c"] = 130.812782650299317; notefreq[3]["c#"] = 138.591315488436048; notefreq[3]["d"] = 146.832383958703780; notefreq[3]["d#"] = 155.563491861040455; notefreq[3]["e"] = 164.813778456434964; notefreq[3]["f"] = 174.614115716501942; ...
... notefreq[3]["f#"] = 184.997211355817199; notefreq[3]["g"] = 195.997717990874647; notefreq[3]["g#"] = 207.652348789972569; notefreq[3]["a"] = 220.000000000000000; notefreq[3]["a#"] = 233.081880759044958; notefreq[3]["b"] = 246.941650628062055; notefreq[4]["c"] = 261.625565300598634; notefreq[4]["c#"] = 277.182630976872096; notefreq[4]["d"] = 293.664767917407560; notefreq[4]["d#"] = 311.126983722080910; notefreq[4]["e"] = 329.627556912869929; notefreq[4]["f"] = 349.228231433003884; notefreq[4]["f#"] = 369.994422711634398; notefreq[4]["g"] = 391.995435981749294; notefreq[4]["g#"] = 415.304697579945138; notefreq[4]["a"] = 440.000000000000000; notefreq[4]["a#"] = 466.163761518089916; notefreq[4]["b"] = 493.883301256124111; notefreq[5]["c"] = 523.251130601197...
...And 2 more matches

WritableStream - Web APIs
webview android full support 59chrome android full support 59firefox android no support noopera android full support 44safari ios ?
... webview android full support 59chrome android full support 59firefox android no support noopera android full support 44safari ios ?
... webview android full support 59chrome android full support 59firefox android no support noopera android full support 44safari ios ?
...And 2 more matches

WebAssembly.Module - JavaScript
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...
... 57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...
... 57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...
...And 2 more matches

The "codecs" parameter in common media types - Web media technologies
7a 00 high 4:4:4 predictive profile (hi444pp) in addition to the capabilities included in hi422p, hi444pp adds support for 4:4:4 chroma subsampling (in which no color information is discarded).
... 44 00 scalable baseline profile intended for use with video conferencing as well as surveillance and mobile uses, the svc baseline profile is based on avc's constrained baseline profile.
...a special value is 40; this indicates that the media is mpeg-4 audio (iso/iec 14496 part 3).
...And 2 more matches

Introducing the Audio API extension - Archive of obsolete content
for example: // create a new audio element var audiooutput = new audio(); // set up audio element with 2 channel, 44.1khz audio stream.
... audiooutput.mozsetup(2, 44100); once this is done, the samples need to be created.
... array var samples = new float32array([0.242, 0.127, 0.0, -0.058, -0.242, ...]); var numbersampleswritten = audiooutput.mozwriteaudio(samples); in the following example, we create an audio pulse: <!doctype html> <html> <head> <title>generating audio in real time</title> <script type="text/javascript"> function playtone() { var output = new audio(); output.mozsetup(1, 44100); var samples = new float32array(22050); for (var i = 0; i < samples.length ; i++) { samples[i] = math.sin( i / 20 ); } output.mozwriteaudio(samples); } </script> </head> <body> <p>this demo plays a one second tone when you click the button below.</p> <button onclick="playtone();">play</button> </body> </html> the mozcurrentsampl...
...for example, if working with two channels at 44100 samples per second, a writing interval of 100 ms, and a pre-buffer equal to 500 ms, one would write an array of (2 * 44100 / 10) = 8820 samples, and a total of (currentsampleoffset + 2 * 44100 / 2).

Index - Learn web development
44 the web and web standards beginner, front-end, learn, web, web standards this article provides some useful background on the web — how it came about, what web standard technologies are, how they work together, why "web developer" is a great career to choose, and what kinds of best practices you'll learn about through the course.
... 144 grids article, beginner, css, css grids, codingscripting, grids, guide, layout, learn, tutorial, grid design, grid framework, grid system in this overview we have toured the main features of css grid layout.
... 244 adding vector graphics to the web beginner, graphics, guide, html, images, learn, raster, svg, vector, iframe, img this article has provided you with a quick tour of what vector graphics and svg are, why they are useful to know about, and how to include svg inside your webpages.
... 344 perceived performance perceived performance, web performance perceived performance is how fast a website seems to the user.

Experimental features in Firefox
nightly 44 no developer edition 44 no beta 44 no release 44 no preference name gfx.offscreencanvas.enabled hit regions whether the mouse coordinates are within a particular area on the canvas is a common problem to solve.
...see bug 934425 for more details.
...see bug 1443863 for more details.
...see bug 1584464 for more details.

DMD
unreported { 150 blocks in heap block record 283 of 5,495 21,600 bytes (20,400 requested / 1,200 slop) individual block sizes: 144 x 150 0.00% of the heap (16.85% cumulative) 0.02% of unreported (94.68% cumulative) allocated at { #01: replace_malloc (/home/njn/moz/mi5/go64dmd/memory/replace/dmd/../../../../memory/replace/dmd/dmd.cpp:1286) #02: malloc (/home/njn/moz/mi5/go64dmd/memory/build/../../../memory/build/replace_malloc.c:153) #03: moz_xmalloc (/home/njn/moz/mi5/memory/mozalloc/mozalloc.cpp:84) #0...
...nscomptr.h:753) #08: nsxmlcontentsink::handlestartelement(char16_t const*, char16_t const**, unsigned int, unsigned int, bool) (/home/njn/moz/mi5/dom/xml/nsxmlcontentsink.cpp:1007) } } it tells you that there were 150 heap blocks that were allocated from the program point indicated by the "allocated at" stack trace, that these blocks took up 21,600 bytes, that all 150 blocks had a size of 144 bytes, and that 1,200 of those bytes were "slop" (wasted space caused by the heap allocator rounding up request sizes).
...rtercallback*, nsisupports*) (/home/njn/moz/mi2/xpcom/base/nscyclecollector.cpp:3075) 0x7f6860fde432 #06: nsmemoryinfodumper::dumpmemoryreportstofileimpl(nsastring_internal const&) (/home/njn/moz/mi2/xpcom/base/nsmemoryinfodumper.cpp:626) 0x7f6860fece79 #07: nsmemoryinfodumper::dumpmemoryreportstofile(nsastring_internal const&, bool, bool) (/home/njn/moz/mi2/xpcom/base/nsmemoryinfodumper.cpp:344) 0x7f6860febaf9 #08: mozilla::(anonymous namespace)::dumpmemoryreportsrunnable::run() (/home/njn/moz/mi2/xpcom/base/nsmemoryinfodumper.cpp:58) 0x7f6860fefe03 } you can tell which memory reporter made the report by the name of the mallocsizeof function near the top of the stack trace.
...for example: unreported { 420,010 blocks in heap block record 2 of 5,495 29,203,408 bytes (27,777,288 requested / 1,426,120 slop) individual block sizes: 2,048 x 3; 1,024 x 103; 512 x 147; 496 x 7; 480 x 31; 464 x 6; 448 x 50; 432 x 41; 416 x 28; 400 x 53; 384 x 43; 368 x 216; 352 x 141; 336 x 58; 320 x 104; 304 x 5,130; 288 x 150; 272 x 591; 256 x 6,017; 240 x 1,372; 224 x 93; 208 x 488; 192 x 1,919; 176 x 18,903; 160 x 1,754; 144 x 5,041; 128 x 36,709; 112 x 5,571; 96 x 6,280; 80 x 40,738; 64 x 37,925; 48 x 78,392; 32 x 136,199; 16 x 31,001; 8 x 4,706 3.78% of the heap (10.24% cumulative) 21.24% of unrepor...

NSS 3.12.4 release notes
stributionpoint extension in libpkix bug 391434: avoid multiple encoding/decoding of pkix_pl_oid to and from ascii string bug 405297: problems building nss/lib/ckfw/capi/ with mingw gcc bug 420991: libpkix returns wrong nss error code bug 427135: add super-h (sh3,4) architecture support bug 431958: improve des and sha512 for x86_64 platform bug 433791: win16 support should be deleted from nss bug 449332: secu_parsecommandline does not validate its inputs bug 453735: when using cert9 (sqlite3) db, set or change master password fails bug 463544: warning: passing enum* for an int* argument in pkix_validate.c bug 469588: coverity errors reported for softoken bug 470055: pkix_httpcertstore_findsocketconnection reuses closed socket bug 470070: multiple object leaks reported by tinderbox bug 470479...
...crash in certutil or pp when printing cert with empty subject name bug 488992: fix lib/freebl/win_rand.c warnings bug 489010: stop exporting mktemp and dbopen (again) bug 489287: resolve a few remaining issues with nss's new revocation flags bug 489710: byteswap optimize for msvc++ bug 490154: cryptokey framework requires module to implement generatekey when they support keypairgeneration bug 491044: remove support for vms (a.k.a., openvms) from nss bug 491174: cert_pkixverifycert reports wrong error code when ee cert is expired bug 491919: cert.h doesn't have valid functions prototypes bug 492131: a failure to import a cert from a p12 file leaves error code set to zero bug 492385: crash freeing named crl entry on shutdown bug 493135: bltest crashes if it can't open the input file bug 493364...
...ebuggable optimized nss builds for mozilla on linux bug 499385: drbg reseed function needs to be tested on post bug 499825: utilrename.h is missing from solaris packages bug 502961: allocator mismatch in pk11mode bug 502965: allocator mismatch in sdrtest bug 502972: another allocator mismatch in sdrtest bug 504398: pkix_pl_aiamgr_gethttpcerts could crash if sec_getregisteredhttpclient fails bug 504405: pkix_pl_crldp_create will fail on alloc success because of a missing !
... bug 504408: pkix_pl_crldp_create will always fail if dp->distpointtype != generalname bug 504456: exploitable heap overflow in nss shell expression (filename globbing) parsing bug 505559: need function to identify the one and only default internal private key slot.

NSS 3.34 release notes
nss 3.34 source distributions are available on ftp.mozilla.org for secure https download: source tarballs: https://ftp.mozilla.org/pub/mozilla.org/security/nss/releases/nss_3_34_rtm/src/ notable changes in nss 3.34 the following ca certificates were added: cn = gdca trustauth r5 root sha-256 fingerprint: bf:ff:8f:d0:44:33:48:7d:6a:8a:a6:0c:1a:29:76:7a:9f:c2:bb:b0:5e:42:0f:71:3a:13:b9:92:89:1d:38:93 trust flags: websites cn = ssl.com root certification authority rsa sha-256 fingerprint: 85:66:6a:56:2e:e0:be:5c:e9:25:c1:d8:89:0a:6f:76:a8:7e:c1:6d:4d:7d:5f:29:ea:74:19:cf:20:12:3b:69 trust flags: websites, email cn = ssl.com root certification authority ecc sha-...
...: websites, email cn = ssl.com ev root certification authority rsa r2 sha-256 fingerprint: 2e:7b:f1:6c:c2:24:85:a7:bb:e2:aa:86:96:75:07:61:b0:ae:39:be:3b:2f:e9:d0:cc:6d:4e:f7:34:91:42:5c trust flags: websites cn = ssl.com ev root certification authority ecc sha-256 fingerprint: 22:a2:c1:f7:bd:ed:70:4c:c1:e7:01:b5:f4:08:c3:10:88:0f:e9:56:b5:de:2a:4a:44:f9:9c:87:3a:25:a7:c8 trust flags: websites cn = trustcor rootcert ca-1 sha-256 fingerprint: d4:0e:9c:86:cd:8f:e4:68:c1:77:69:59:f4:9e:a7:74:fa:54:86:84:b6:c4:06:f3:90:92:61:f4:dc:e2:57:5c trust flags: websites, email cn = trustcor rootcert ca-2 sha-256 fingerprint: 07:53:e9:40:37:8c:1b:d5:e3:83:6e:39:5d:ae:a5:cb:83:9e:50:46:f1:bd:0e:ae:19:51:c...
...:31:aa:49:20:e8:13:b2:d1:98:60:8c:b7:b7:cf:e2:11:43:b8:36:df:09:ea cn = startcom certification authority sha-256 fingerprint: e1:78:90:ee:09:a3:fb:f4:f4:8b:9c:41:4a:17:d6:37:b7:a5:06:47:e9:bc:75:23:22:72:7f:cc:17:42:a9:11 cn = startcom certification authority g2 sha-256 fingerprint: c7:ba:65:67:de:93:a7:98:ae:1f:aa:79:1e:71:2d:37:8f:ae:1f:93:c4:39:7f:ea:44:1b:b7:cb:e6:fd:59:95 cn = tÜbİtak uekae kök sertifika hizmet sağlayıcısı - sürüm 3 sha-256 fingerprint: e4:c7:34:30:d7:a5:b5:09:25:df:43:37:0a:0d:21:6e:9a:79:b9:d6:db:83:73:a0:c6:9e:b1:cc:31:c7:c5:2a cn = acedicom root sha-256 fingerprint: 03:95:0f:b4:9a:53:1f:3e:19:91:94:23:98:df:a9:e0:ea:32:d7:ba:1c:dd:9b:c8:5d:b5:7e:d9:40:0b:43:4a ...
...print: fc:bf:e2:88:62:06:f7:2b:27:59:3c:8b:07:02:97:e1:2d:76:9e:d1:0e:d7:93:07:05:a8:09:8e:ff:c1:4d:17 cn = tÜrktrust elektronik sertifika hizmet sağlayıcısı sha-256 fingerprint: 97:8c:d9:66:f2:fa:a0:7b:a7:aa:95:00:d9:c0:2e:9d:77:f2:cd:ad:a6:ad:6b:a7:4a:f4:b9:1c:66:59:3c:50 cn = pscprocert sha-256 fingerprint: 3c:fc:3c:14:d1:f6:84:ff:17:e3:8c:43:ca:44:0c:00:b9:67:ec:93:3e:8b:fe:06:4c:a1:d7:2c:90:f2:ad:b0 cn = ca 沃通根证书, o=wosign ca limited sha-256 fingerprint: d6:f0:34:bd:94:aa:23:3f:02:97:ec:a4:24:5b:28:39:73:e4:47:aa:59:0f:31:0c:77:f4:8f:df:83:11:22:54 cn = certification authority of wosign sha-256 fingerprint: 4b:22:d5:a6:ae:c9:9f:3c:db:79:aa:5e:c0:68:38:47:9c:d5:ec:ba:71:64:f7:f2:2d:c1:d...

NSS 3.54 release notes
certificate authority changes the following ca certificates were added: bug 1645186 - certsign root ca g2 sha-256 fingerprint: 657cfe2fa73faa38462571f332a2363a46fce7020951710702cdfbb6eeda3305 bug 1645174 - e-szigno root ca 2017 sha-256 fingerprint: beb00b30839b9bc32c32e4447905950641f26421b15ed089198b518ae2ea1b99 bug 1641716 - microsoft ecc root certificate authority 2017 sha-256 fingerprint: 358df39d764af9e1b766e9c972df352ee15cfac227af6ad1d70e8e4a6edcba02 bug 1641716 - microsoft rsa root certificate authority 2017 sha-256 fingerprint: c741f70f4b2a8d88bf2e71c14122ef53ef10eba0cfa5e64cfa20f418853073e0 the fol...
...tes were removed: bug 1645199 - addtrust class 1 ca root sha-256 fingerprint: 8c7209279ac04e275e16d07fd3b775e80154b5968046e31f52dd25766324e9a7 bug 1645199 - addtrust external ca root sha-256 fingerprint: 687fa451382278fff0c8b11f8d43d576671c6eb2bceab413fb83d965d06d2ff2 bug 1641718 - luxtrust global root 2 sha-256 fingerprint: 54455f7129c20b1447c418f997168f24c58fc5023bf5da5be2eb6e1dd8902ed5 bug 1639987 - staat der nederlanden root ca - g2 sha-256 fingerprint: 668c83947da63b724bece1743c31a0e6aed0db8ec5b31be377bb784f91b6716f bug 1618402 - symantec class 2 public primary certification authority - g4 sha-256 fingerprint: fe863d0822fe7a2353fa484d5924e875656d3dc9fb58771f6f616f9d571bc59...
...2 bug 1618402 - symantec class 1 public primary certification authority - g4 sha-256 fingerprint: 363f3c849eab03b0a2a0f636d7b86d04d3ac7fcfe26a0a9121ab9795f6e176df bug 1618402 - verisign class 3 public primary certification authority - g3 sha-256 fingerprint: eb04cf5eb1f39afa762f2bb120f296cba520c1b97db1589565b81cb9a17b7244 a number of certificates had their email trust bit disabled.
... bug 1644774 - ssl gtests to use clearservercache when resetting self-encrypt keys.

DOMMatrixReadOnly - Web APIs
m11, m12, m13, m14, m21, m22, m23, m24, m31, m32, m33, m34, m41, m42, m43, m44 double-precision floating-point values representing each component of a 4×4 matrix, where m11 through m14 are the first column, m21 through m24 are the second column, and so forth.
... dommatrixreadonly.tofloat32array() returns a new float32array containing all 16 elements (m11, m12, m13, m14, m21, m22, m23, m24, m31, m32, m33, m34, m41, m42, m43, m44) which comprise the matrix.
...(in other words, down the first column from top to bottom, then the second column, and so forth.) dommatrixreadonly.tofloat64array() returns a new float64array containing all 16 elements (m11, m12, m13, m14, m21, m22, m23, m24, m31, m32, m33, m34, m41, m42, m43, m44) which comprise the matrix.
... for a 3d matrix, the returned string contains all 16 elements and takes the form matrix3d(m11, m12, m13, m14, m21, m22, m23, m24, m31, m32, m33, m34, m41, m42, m43, m44).

Fullscreen API - Web APIs
no support 9 — 65notes alternate name notes before firefox 44, firefox incorrectly allowed elements inside a <frame> or <object> element to request, and to be granted, fullscreen.
... in firefox 44 and onwards this has been fixed: only elements in the top-level document or in an <iframe> element with the allowfullscreen attribute can be displayed fullscreen.alternate name uses the non-standard name: mozrequestfullscreenie full support 11prefixed full support 11prefixed prefixed implemented with the vendor prefix: msopera full support 58 full support 58 full support 15prefixed prefixed implemented with the vendor prefix: webkit no support 12 — 15prefixed prefixed implemented with the vendor prefix: osafari ...
... no support 9 — 65notes alternate name notes before firefox 44, firefox incorrectly allowed elements inside a <frame> or an <object> to request, and to be granted, fullscreen.
... in firefox 44 and onwards this has been fixed: only elements in the top-level document or in an <iframe> with the allowfullscreen attribute can be displayed fullscreen.alternate name uses the non-standard name: mozrequestfullscreenopera android full support 50 full support 50 full support 14prefixed prefixed implemented with the vendor prefix: webkit no support 12 — 14prefixed prefixed implemented with the vendor prefix: osafari ios full support 6prefixed notes full support 6prefixed notes prefixed implemented with the vendor prefix: webkitn...

WebGL constants - Web APIs
80a9 sample_coverage_value 0x80aa sample_coverage_invert 0x80ab compressed_texture_formats 0x86a3 vendor 0x1f00 renderer 0x1f01 version 0x1f02 implementation_color_read_type 0x8b9a implementation_color_read_format 0x8b9b browser_default_webgl 0x9244 buffers constants passed to webglrenderingcontext.bufferdata(), webglrenderingcontext.buffersubdata(), webglrenderingcontext.bindbuffer(), or webglrenderingcontext.getbufferparameter().
... constant name value description cull_face 0x0b44 passed to enable/disable to turn on/off culling.
...fer 0x8d40 renderbuffer 0x8d41 rgba4 0x8056 rgb5_a1 0x8057 rgb565 0x8d62 depth_component16 0x81a5 stencil_index8 0x8d48 depth_stencil 0x84f9 renderbuffer_width 0x8d42 renderbuffer_height 0x8d43 renderbuffer_internal_format 0x8d44 renderbuffer_red_size 0x8d50 renderbuffer_green_size 0x8d51 renderbuffer_blue_size 0x8d52 renderbuffer_alpha_size 0x8d53 renderbuffer_depth_size 0x8d54 renderbuffer_stencil_size 0x8d55 framebuffer_attachment_object_type 0x8cd0 framebuffer_attachment_object_name 0...
... uniform_array_stride 0x8a3c uniform_matrix_stride 0x8a3d uniform_is_row_major 0x8a3e uniform_block_binding 0x8a3f uniform_block_data_size 0x8a40 uniform_block_active_uniforms 0x8a42 uniform_block_active_uniform_indices 0x8a43 uniform_block_referenced_by_vertex_shader 0x8a44 uniform_block_referenced_by_fragment_shader 0x8a46 sync objects constant name value description object_type 0x9112 sync_condition 0x9113 sync_status 0x9114 sync_flags 0x9115 sync_fence 0x9116 sync_gpu_commands_complete 0x9117 unsignaled ...

WebAssembly.Memory - JavaScript
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...
... 57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...
... 57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...
... 57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...

Digital audio concepts - Web media technologies
44100 hz the 44.1 khz sample rate is used for compact disc (cd) audio.
... cds provide uncompressed 16-bit stereo sound at 44.1 khz.
... there is a reason why 44.1 khz is considered the minimum "high fidelity" sampling rate.
...doubling that per the nyquist theorem results in a final minimum frequency of (you guessed it) 44.1 khz.

SVG documentation index - SVG: Scalable Vector Graphics
44 color svg, svg attribute the color attribute is used to provide a potential indirect value, currentcolor, for the fill, stroke, stop-color, flood-color, and lighting-color attributes.
... 144 numoctaves filters, svg, svg attribute the numoctaves attribute defines the number of octaves for the noise function of the <feturbulence> primitive.
... 244 viewbox svg, svg attribute the viewbox attribute defines the position and dimension, in user space, of an svg viewport.
... 344 <glyph> element, reference, svg, svg text content a <glyph> defines a single glyph in an svg font.

Creating Reusable Modules - Archive of obsolete content
e for a byte function tohexstring(charcode) { return ("0" + charcode.tostring(16)).slice(-2); } function md5file(path) { var f = cc["@mozilla.org/file/local;1"] .createinstance(ci.nsilocalfile); f.initwithpath(path); var istream = cc["@mozilla.org/network/file-input-stream;1"] .createinstance(ci.nsifileinputstream); // open for reading istream.init(f, 0x01, 0444, 0); var ch = cc["@mozilla.org/security/hash;1"] .createinstance(ci.nsicryptohash); // we want to use the md5 algorithm ch.init(ch.md5); // this tells updatefromstream to read the entire file const pr_uint32_max = 0xffffffff; ch.updatefromstream(istream, pr_uint32_max); // pass false here to get binary data back var hash = ch.finish(false); // convert the binary has...
...e for a byte function tohexstring(charcode) { return ("0" + charcode.tostring(16)).slice(-2); } function md5file(path) { var f = cc["@mozilla.org/file/local;1"] .createinstance(ci.nsilocalfile); f.initwithpath(path); var istream = cc["@mozilla.org/network/file-input-stream;1"] .createinstance(ci.nsifileinputstream); // open for reading istream.init(f, 0x01, 0444, 0); var ch = cc["@mozilla.org/security/hash;1"] .createinstance(ci.nsicryptohash); // we want to use the md5 algorithm ch.init(ch.md5); // this tells updatefromstream to read the entire file const pr_uint32_max = 0xffffffff; ch.updatefromstream(istream, pr_uint32_max); // pass false here to get binary data back var hash = ch.finish(false); // convert the binary has...
...e for a byte function tohexstring(charcode) { return ("0" + charcode.tostring(16)).slice(-2); } function md5file(path) { var f = cc["@mozilla.org/file/local;1"] .createinstance(ci.nsilocalfile); f.initwithpath(path); var istream = cc["@mozilla.org/network/file-input-stream;1"] .createinstance(ci.nsifileinputstream); // open for reading istream.init(f, 0x01, 0444, 0); var ch = cc["@mozilla.org/security/hash;1"] .createinstance(ci.nsicryptohash); // we want to use the md5 algorithm ch.init(ch.md5); // this tells updatefromstream to read the entire file const pr_uint32_max = 0xffffffff; ch.updatefromstream(istream, pr_uint32_max); // pass false here to get binary data back var hash = ch.finish(false); // convert the binary has...

StringView - Archive of obsolete content
pecftdqvxbxufeqv/dzmyudx+eaaaaaadzw2aqsipsceidxajdaaaaaqacaehlbgxvihdvcmxkiqaaaaabgwm7maaaaauaaaac/v//faaaafz+//9maaaatp///6qaaabs////xaaaanz///8maqaafaaaaaaaaaabeliaaxgqarsmbwiqaqcqfaaaabwaaaai/v//kgaaaaaaaaaaaaaafaaaaaaaaaabeliaaxgqarsmbwiqaqaajaaaabwaaacy/f//qaaaaaaoeeyogeopc3cigaa/gjsqmyqiaaaaabwaaabeaaaaop7//xuaaaaaqq4qhgjddqzqdaciaaaaraaaagqaaacg/v//zqaaaabcdhcpakuogi4drq4gjqrfdiimbugomiygsa44gwdndkbsdjhbdjbbdihcdibcdhhcdhbcdggafaaaakwaaadi/v//agaaaaaaaaaaaaaaaaaaaaaaaadqbeaaaaaaalaeqaaaaaaaaaaaaaaaaaabaaaaaaaaaaeaaaaaaaaadaaaaaaaaacoa0aaaaaaaa0aaaaaaaaalavaaaaaaaazaaaaaaaaaoagyaaaaaaagwaaaaaaaaaiaaaaaaaaaboaaaaaaaaa6azgaaaaaaacaaaaaaaaaagaaaaaaaaa9f7/bwaaaabgakaaaaaaaauaaaaaaaaa4ajaaaaaaaagaaaaaaaaaiacqaaaaaaacgaaaaaaaaa9aaaaaaaaaasaaaaaaaaagaaaaaaaaaavaaaaaaaaaaaaaaaaaaaaawaaaaaaaadq...
...caaaaaaaaafwaaaaaaaabga0aaaaaaaacaaaaaaaaasanaaaaaaaaiaaaaaaaaabgaaaaaaaaacqaaaaaaaaayaaaaaaaaap7//28aaaaakanaaaaaaad///9vaaaaaaeaaaaaaaaa8p//bwaaaaaea0aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa+azgaaaaaaaaaaaaaaaaaaaaaaaaaaaa5gnaaaaaaad2a0aaaaaaaayeqaaaaaaaaaaaaaaaaaaaaaaaaaaaaeddqzogkedovskgnc44ljagmjaxmza1mdigkhbyzxjlbgvhc2upaeddqzogkedovskgnc44ljeaac5zew10ywialnn0cnrhygauc2hzdhj0ywialmludgvycaaubm90zs5bqkktdgfnac5ub3rllmduds5idwlszc1pzaauz251lmhhc2galmr5bnn5bqauzhluc3ryac5nbnuudmvyc2lvbgauz251lnzlcnnpb25fcgaucmvsys5kew4alnjlbgeucgx0ac5pbml0ac50zxh0ac5maw5pac5yb2rhdgealmvox2zyyw1lx2hkcgauzwhfznjhbwualmluaxrfyxjyyxkalmzpbmlfyxjyyxkalmpjcgauzhluyw1pywauz290ac5nb3qucgx0ac5kyxrhac5ic3malmnv...
...efctevfaf9fbgliy19jc3vfzmluaqbfsvrnx2rlcmvnaxn0zxjutunsb25lvgfibguazgf0yv9zdgfydabwdxrzqebhtelcq18yljiunqbfzwrhdgeax2zpbmkax19sawjjx3n0yxj0x21haw5aqedmsujdxziumi41af9fzgf0yv9zdgfydabfx2dtb25fc3rhcnrfxwbfx2rzb19oyw5kbguax0lpx3n0zglux3vzzwqax19sawjjx2nzdv9pbml0af9lbmqax3n0yxj0af9fynnzx3n0yxj0ag1haw4ax0p2x1jlz2lzdgvyq2xhc3nlcwbfx1rnq19ftkrfxwbfsvrnx3jlz2lzdgvyve1dbg9uzvrhymxlaf9pbml0aa==", "ascii", 1444, 12); alert(string.fromcharcode.apply(null, swhelloworld.bufferview)); // swhelloworld.buffer contains the whole file alert(swhelloworld); // "hello world" /* traslating "hello world" into italian...

What is RSS - Archive of obsolete content
tem> <item> <title>big news today: birds fly</title> <guid ispermalink="false">c4a63f09-b45b-466b-8773-6ff264001ab7</guid> <pubdate>tue, 19 jul 2005 04:32:51 -0700</pubdate> <link>http://news.example.com/artcle/553</link> </item> <item> <title>fire is hot</title> <guid ispermalink="false">c1795324-d5ea-44fa-95b1-b5ce2090d4f1</guid> <pubdate>sun, 15 may 2005 13:02:08 -0700</pubdate> <link>http://news.example.com/artcle/552</link> </item> </channel> </rss> bloggers use rss to provide everyone with a list of their newest blog posts.
...g 2005 21:02:05 -0800</pubdate> <enclosure url="http://katetv.example.com/show/4" length="1911146" type="application/ogg"/> </item> <item> <title>watch this</title> <guid>http://katetv.example.com/show/3</guid> <pubdate>tue, 16 aug 2005 16:11:57 -0400</pubdate> <enclosure url="http://katetv.example.com/show/3" length="1387442" type="application/ogg"/> </item> <item> <title>it is me again</title> <guid>http://katetv.example.com/show/2</guid> <pubdate>tue, 9 aug 2005 13:12:12 -0400</pubdate> <enclosure url="http://katetv.example.com/show/2" length="1894877" type="video/mpeg"/> </item> <item> <title>hello</title> <gui...
...d>http://katetv.example.com/show/1</guid> <pubdate>tue, 2 aug 2005 18:22:14 -0400</pubdate> <enclosure url="http://katetv.example.com/show/1" length="17442215" type="application/ogg"/> </item> </channel> </rss> the observant reader may have noticed that the news web site and blogger examples were the same type of rss.

Setting up your own test automation environment - Learn web development
ntil = webdriver.until, username = "your-user-name", accesskey = "your-access-key"; let driver = new webdriver.builder() .withcapabilities({ 'browsername': 'chrome', 'platform': 'windows xp', 'version': '43.0', 'username': username, 'accesskey': accesskey }) .usingserver("https://" + username + ":" + accesskey + "@ondemand.saucelabs.com:443/wd/hub") .build(); driver.get('http://www.google.com'); driver.findelement(by.name('q')).sendkeys('webdriver'); driver.sleep(1000).then(function() { driver.findelement(by.name('q')).sendkeys(webdriver.key.tab); }); driver.findelement(by.name('btnk')).click(); driver.sleep(2000).then(function() { driver.gettitle().then(function(title) { if(title === 'webdriver - google search') {...
... the server will run on http://localhost:4444/wd/hub — try going there now to see what you get.
... update the second code block (which starts with let driver = ...) like so let driver = new webdriver.builder() .forbrowser('firefox') .usingserver('http://localhost:4444/wd/hub') .build(); run your test, and you should see it run as expected; this time however you will be runing it on the standalone server: node google_test_remote.js so this is pretty cool.

Mozilla’s UAAG evaluation report
when filing mozilla bugs based on uaag requirements, please use bug 24413 as the uaag meta bug.
...(p1) p the following line can be added to a user's prefs.js file to control blinking: user_pref("browser.blink_allowed", false); bug 89144 has been filed to expose this pref in the ui.
...(p3) p can turn on and off toolbars under show/hide can customize personal bookmarks toolbar bug 15144 is for the ability to add/remove toolbar icons bug 47418 is for the ability to rearrange toolbars guideline 12.

BloatView
class name instance size bytes allocated bytes allocated but not freed blank mozilla yahoo netscape total blank mozilla yahoo netscape total total 1754408 432556 179828 404184 2770976 nsstr 20 6261600 3781900 1120920 1791340 12955760 222760 48760 13280 76160 360960 nshashkey 8 610568 1842400 2457872 1134592 6045432 32000 536 568 1216 34320 nstexttransformer 548 8220 469088 1414936 1532756 3425000 ...
... 0 0 0 0 0 nsstylecontextdata 736 259808 325312 489440 338560 1413120 141312 220800 -11040 94944 446016 nslinelayout 1100 2200 225500 402600 562100 1192400 0 0 0 0 0 nslocalfile 424 558832 19928 1696 1272 581728 72080 1272 424 -424 73352 the first set of columns, bytes allocated, shows the amount of memory allocated for the first log file (blank.txt), the difference between the first log file and the second (mozilla.txt), the difference between the second log file and the third (yahoo.txt), the difference between the third log file and the fourth (netscape.txt), and the total amount of memory allocated in the fourth log f...
...33450.txt previous file: dist/win32_d.obj/bin/bloatlogs/all-1999-10-16-010302.txt -------------------------------------------------------------------------- class leaks delta bloat delta -------------------------------------------------------------------------- total 6113530 2.79% 67064808 9.18% stylecontextimpl 265440 81.19% 283584 -26.99% ctoken 236500 17.32% 306676 20.64% nsstr 217760 14.94% 5817060 7.63% nsxulattribute 113048 -70.92% 113568 -71.16% literalimpl 53280 26.62% 75840 19.40% nsxulelement 51648 0.00% 51648 0.00% nsprofile ...

TimerFirings logging
2082435840[100445640]: [81190] fn timer (one_shot 8000 ms): [from dladdr] gfxfontinfoloader::delayedstartcallback(nsitimer*, void*) second, on linux the code uses dladdr to get the symbol library and address, which can be post-processed by tools/rb/fix_stacks.py.
... 2088737280[7f606bf68140]: [30710] fn timer (one_shot 16 ms): [from dladdr] #0: ???[/home/njn/moz/mi1/o64/dist/bin/libxul.so +0x2144f94] 2088737280[7f606bf68140]: [30710] fn timer (one_shot 16 ms): [from dladdr] #0: mozilla::refreshdrivertimer::timertick(nsitimer*, void*) (/home/njn/moz/mi1/o64/layout/b third, on other platforms dladdr is not implemented or doesn't work well, and the output will look like the followin.
...0]: [7163] fn timer (one_shot 100 ms): [content] http://a.visualrevenue.com/vrs.js:6:9423 103 801266240[7f7c1f248000]: [7163] fn timer (one_shot 50 ms): [content] http://static.dynamicyield.com/scripts/12086/dy-min.js?v=12086:3:3389 94 801266240[7f7c1f248000]: [7163] fn timer (one_shot 50 ms): [content] https://ad.doubleclick.net/ddm/adi/n7921.1283839cadreon.com.au/b9038144.122190976;sz=300x600;click=http://pixel.mathtag.com/click/img?mt_aid=2744535504761193354&mt_id=1895890&mt_adid=148611&mt_sid=973379&mt_exid=9&mt_inapp=0&mt_uuid=353d5460-19f6-4400-9bbd-d0fcc3bcf595&mt_3pck=http%3a//beacon-apac-hkg1.rubiconproject.com/beacon/t/d1f9921d-4e47-448f-b6ba-36cae1c31b65/&redirect=;ord=2744535504761193354?:83:0 94 801266240[7f7c1f248000]: [7163] fn timer (one_shot...

powermetrics
the following is example output from such an invocation: *** sampled system activity (fri sep 4 17:15:14 2015 +1000) (5009.63ms elapsed) *** *** running tasks *** name id cpu ms/s user% deadlines (<2 ms, 2-5 ms) wakeups (intr, pkg idle) gpu ms/s com.apple.terminal 293 447.66 274.83 120.35 221.74 firefox 84627 77.59 55.55 15.37 2.59 91.42 42.12 204.47 plugin-container 84628 377.22 37.18 43.91 18.56 178.65 75.85 17.29 terminal 694 9.86 79.94 0.00 0.00 4.
...gle chrome helper 84685 0.13 48.08 0.00 0.00 0.40 0.20 0.00 kernel_coalition 1 128.64 780.19 330.52 0.00 kernel_task 0 109.97 0.00 0.20 0.00 779.47 330.35 0.00 launchd 1 18.88 2.44 0.00 0.00 0.40 0.20 0.00 com.apple.safari 488 90.60 108.58 56.48 26.65 com.apple.webkit.webcontent 84679 64.21 84.69 0.00 0.00 104.19 54.89 26.66 com.apple.webkit.networking 84678 26.89 58.89 0.40 0.00 1.60 0.00 ...
... 0.00 safari 84676 1.56 55.74 0.00 0.00 2.59 1.40 0.00 com.apple.safari.searchhelper 84690 0.15 49.49 0.00 0.00 0.20 0.20 0.00 org.mozilla.firefox 482 76.56 124.34 63.47 0.00 firefox 84496 76.70 89.18 10.58 5.59 124.55 63.48 0.00 this sample was taken while the following programs were running: firefox beta (single process, invoked from the mac os dock, shown in the org.mozilla.firefox coalition.) firefox nightly (multi-process, invoked from the command line, shown in the com.apple.terminal coalition.) google chrome.

NSS_3.12.1_release_notes.html
ized pkcs#5 v2 pbes bug 403543: pkix: need a way to enable/disable aia cert fetching bug 408847: pkix_ocspchecker_check does not support specified responder (and given signercert) bug 414003: crash [[@ cert_decodecertpackage] sometimes with this testcase bug 415167: memory leak in certutil bug 417399: arena allocation results are not checked in pkix_pl_infoaccess_parselocation bug 420644: improve ssl tracing of key derivation bug 426886: use const char* in pk11_importcertforkey bug 428103: cert_encodesubjectkeyid is not defined in any public header file bug 429716: debug builds of libpkix unconditionally dump socket traffic to stdout bug 430368: vfychain -t option is undocumented bug 430369: vfychain -o succeeds even if -pp is not specified bug 430399: vfychain -pp cr...
... bug 439123: assertion failure in libpkix at shutdown bug 440062: incorrect list element count in pkix_list_appenditem function bug 442618: eliminate dead function cert_certpackagetype bug 443755: extra semicolon in pkm_tlskeyandmacderive makes conditional code unconditional bug 443760: extra semicolon in seqdatabase makes static analysis tool suspicious bug 448323: certutil -k doesn't report the token and slot names for found keys bug 448324: oc...
...sp checker returns incorrect error code on request with invalid signing cert bug 449146: remove dead libsec function declarations bug 453227: installation of pem-encoded certificate without trailing newline fails documentation for a list of the primary nss documentation pages on mozilla.org, see nss documentation.

NSS 3.32 release notes
0:9b:d4:ea:4f:4a:99:d5:58:b4:6e:4c:25:cd:81:14:0d:29:c0:56:13:91:4c:38:41 the following ca certificates were removed: cn = addtrust public ca root sha-256 fingerprint: 07:91:ca:07:49:b2:07:82:aa:d3:c7:d7:bd:0c:df:c9:48:58:35:84:3e:b2:d7:99:60:09:ce:43:ab:6c:69:27 cn = addtrust qualified ca root sha-256 fingerprint: 80:95:21:08:05:db:4b:bc:35:5e:44:28:d8:fd:6e:c2:cd:e3:ab:5f:b9:7a:99:42:98:8e:b8:f4:dc:d0:60:16 cn = china internet network information center ev certificates root sha-256 fingerprint: 1c:01:c6:f4:db:b2:fe:fc:22:55:8b:2b:ca:32:56:3f:49:84:4a:cf:c3:2b:7b:e4:b0:ff:59:9f:9e:8c:7a:f7 cn = cnnic root sha-256 fingerprint: e2:83:93:77:3d:a8:45:a6:79:f2:08:0c:c7:fb:44:a3:b7:a1:c3:79:2c:b7:eb:7...
...7:29:fd:cb:6a:8d:99:ae:a7 cn = comsign secured ca sha-256 fingerprint: 50:79:41:c7:44:60:a0:b4:70:86:22:0d:4e:99:32:57:2a:b5:d1:b5:bb:cb:89:80:ab:1c:b1:76:51:a8:44:d2 cn = geotrust global ca 2 sha-256 fingerprint: ca:2d:82:a0:86:77:07:2f:8a:b6:76:4f:f0:35:67:6c:fe:3e:5e:32:5e:01:21:72:df:3f:92:09:6d:b7:9b:85 cn = secure certificate services sha-256 fingerprint: bd:81:ce:3b:4f:65:91:d1:1a:67:b5:fc:7a:47:fd:ef:25:52:1b:f9:aa:4e:18:b9:e3:df:2e:34:a7:80:3b:e8 cn = swisscom root ca 1 sha-256 fingerprint: 21:db:20:12:36:60:bb:2e:d4:18:20:5d:a1:1e:e7:a8:5a:65:e2:bc:6e:55:b5:af:7e:78:99:c8:a2:66:d9:2e cn = swisscom root ev ca 2 sha-256 fingerprint: d9:5f:ea:3c:a4:ee:dc:e7:4c:d7:6e:75:fc:6d:1...
...f:f6:2c:44:1f:0f:a8:bc:77:f0:34:b1:9e:5d:b2:58:01:5d cn = trusted certificate services sha-256 fingerprint: 3f:06:e5:56:81:d4:96:f5:be:16:9e:b5:38:9f:9f:2b:8f:f6:1e:17:08:df:68:81:72:48:49:cd:5d:27:cb:69 cn = utn-userfirst-hardware sha-256 fingerprint: 6e:a5:47:41:d0:04:66:7e:ed:1b:48:16:63:4a:a3:a7:9e:6e:4b:96:95:0f:82:79:da:fc:8d:9b:d8:81:21:37 cn = utn-userfirst-object sha-256 fingerprint: 6f:ff:78:e4:00:a7:0c:11:01:1c:d8:59:77:c4:59:fb:5a:f9:6a:3d:f0:54:08:20:d0:f4:b8:60:78:75:e5:8f bugs fixed in nss 3.32 nss versions 3.28.x, 3.29.x.

sslerr.html
rror_rx_unexpected_hello_request -12247 "ssl received an unexpected hello request handshake message." ssl_error_rx_unexpected_client_hello -12246 "ssl received an unexpected client hello handshake message." ssl_error_rx_unexpected_server_hello -12245 "ssl received an unexpected server hello handshake message." ssl_error_rx_unexpected_certificate -12244 "ssl received an unexpected certificate handshake message." ssl_error_rx_unexpected_server_key_exch -12243 "ssl received an unexpected server key exchange handshake message." ssl_error_rx_unexpected_cert_request -12242 "ssl received an unexpected certificate request handshake message." ssl_error_rx_unexpected_hello_done -12241 "ssl received an unex...
... sec_error_unsupported_keyalg -8144 unsupported or unknown key algorithm.
... sec_error_revoked_certificate_crl -8047 "certificate is revoked in issuer's certificate revocation list." sec_error_revoked_certificate_ocsp -8046 "issuer's ocsp responder reports certificate is revoked." sec_error_crl_invalid_version -8045 "issuer's certificate revocation list has an unknown version number." sec_error_crl_v1_critical_extension -8044 "issuer's v1 certificate revocation list has a critical extension." sec_error_crl_unknown_critical_extension -8043 "issuer's v2 certificate revocation list has an unknown critical extension." sec_error_unknown_object_type -8042 "unknown object type specified." sec_error_incompatible_pkcs11 -8041 "pkcs #11 driver violates the spec in an incompatible ...

JSClass
jsclass { const char *name; uint32_t flags; /* optional since spidermonkey 37 */ jspropertyop addproperty; jsdeletepropertyop delproperty; jspropertyop getproperty; jsstrictpropertyop setproperty; jsenumerateop enumerate; jsresolveop resolve; jsconvertop convert; /* obsolete since spidermonkey 44 */ /* optional since spidermonkey 25 */ jsfinalizeop finalize; /* optional */ jsclassinternal reserved0; /* obsolete since spidermonkey 13 */ jscheckaccessop checkaccess; /* obsolete since spidermonkey 29 */ jsnative call; jshasinstanceop hasinstance; jsnative construct; jsxdrobjectop xdrobject; /* obsolet...
...obsolete since jsapi 44 use null or js_convertstub (spidermonkey 31 or older) for default behavior, which is equivalent to that defined by ecmascript in §8.12.8.
...vp, object_to_jsval(obj)); */ return true; } { js_initclass(cx, global, js::null(), &printer_class, printer_construct, 1, null, null, null, null); } see also mxr id search for jsclass jsclass.flags js_getclass js_initclass js_newobject js_newobjectforconstructor js_instanceof bug 638291 - added trace bug 702507 - removed jsclass_construct_prototype bug 726944 - removed xdrobject, reserved0 and reserved1 bug 886829 - made finalize optional bug 957688 - removed checkaccess bug 1103368 - made most of members optional bug 1097267 - removed jsclass_new_enumerate bug 1054756 - removed convert bug 1261723 - class ops are moved to a sub-structure jsclassops ...

Secure Development Guidelines
bits maximum value that can be represented data type 8 28-1 255 char 16 216-1 65535 short 32 232-1 4294967295 int 64 264-1 18446744073709551615 long long integer overflows/underflows example of an integer overflow int main() { unsigned int foo = 0xffffffff; printf(“foo: 0x%08x\r\n”, foo); foo++; printf(“foo: 0x%08x\r\n”, foo); } integer overflows/underflows example of an integer underflow int main() { unsigned int foo = 0; printf(“foo: 0x%08x\r\n”, foo); ...
...range 8 signed char -128 - +127 unsigned char 0 - +255 16 signed short -32768 - +32767 unsigned short 0 - +65535 32 signed int -2147483648 - +2147483647 unsigned int 0 - +4294967295 64 signed long long -9223372036854775808 - +9223372036854775807 unsigned long long 0 - +18446744073709551615 int vuln_funct(int size) { char buf[1024]; if (size > sizeof(buf) - 1) return -1; } signedness issues: don’t mix signed and unsigned integers use unsigned integers for sizes, offsets, and indexes casting and truncation example: void vuln_funct() { u_int32_t size1 = 0xffffffff; u_int16_t size2 = size1; void *ptr = malloc(size2); ...
... memory leaks example: void *p; size_t new_size; p = realloc(p, new_size); if (p == null) { /* handle error */ } memory leaks: prevention tools like valgrind can help detect memory leaks writing secure code: object management reference counting issues real-life example (bug 440230) void addref() { ++mrefcnt; ns_log_addref(this, mrefcnt, "nscssvalue::array", sizeof(*this)); } void release() { --mrefcnt; ns_log_release(this, mrefcnt, "nscssvalue::array"); if (mrefcnt == 0) delete this; } reference counting issues: prevention use the largest data type available on your platform for your reference counter use a hard limit con...

Plug-in Basics - Plugins
i found other way how check which paths support firefox : $ strace -y /usr/bin/firefox 2>&1 | grep acces | grep -v search | grep plugins access("/home/user_name/.mozilla/firefox/dqh2nb5k.default-1441864569209/plugins", f_ok) = -1 enoent (no such file or directory) access("/home/user_name/.mozilla/plugins", f_ok) = -1 enoent (no such file or directory) access("/usr/lib64/firefox/browser/plugins", f_ok) = -1 enoent (no such file or directory) access("/usr/lib/mozilla/plugins", f_ok) = 0 this output i have after close firefox.
... example 1: nesting object elements <html> <head> <title>example 1: nesting object elements</title> <style type="text/css"> .myplugin { width: 470px; height: 231px; } </style> </head> <body><p> <object classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" codebase="http://download.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#version=5,0,30,0" class="myplugin"> <param name="movie" value="foo.swf"/> <param name="quality" value="high"/> <param name="salign" value="tl"/> <param name="menu" value="0"/> <object data="foo_movie.swf" type="application/x-shockwave-flash" class...
... example 2: embed within object <object classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" codebase="http://download.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#version=5,0,30,0" width="749" height="68"> <param name="movie" value="foo.swf"> <param name="quality" value="high"> <param name="bgcolor" value="#eeeeee"> <param name="salign" value="tl"> <param name="menu" value="0"> <embed src="foo.swf" quality="high" pluginspage="http://www.macromedia.com/...

characteristic - Web APIs
full support ≤79notes notes windows 10.firefox no support noie no support noopera full support 44notes full support 44notes notes macos only.
... full support 44notes disabled notes linux and versions of windows earlier than 10.disabled from version 44: this feature is behind the #enable-experimental-web-platform-features preference (needs to be set to enabled).
... 57notes notes windows 10.safari no support nowebview android no support nochrome android full support 57firefox android no support noopera android full support 44safari ios no support nosamsung internet android full support 7.0legend full support full support no support no supportexperimental.

readValue() - Web APIs
full support ≤79notes notes windows 10.firefox no support noie no support noopera full support 44notes full support 44notes notes macos only.
... full support 44notes disabled notes linux and versions of windows earlier than 10.disabled from version 44: this feature is behind the #enable-experimental-web-platform-features preference (needs to be set to enabled).
... 57notes notes windows 10.safari no support nowebview android no support nochrome android full support 57firefox android no support noopera android full support 44safari ios no support nosamsung internet android full support 7.0legend full support full support no support no supportexperimental.

uuid - Web APIs
full support ≤79notes notes windows 10.firefox no support noie no support noopera full support 44notes full support 44notes notes macos only.
... full support 44notes disabled notes linux and versions of windows earlier than 10.disabled from version 44: this feature is behind the #enable-experimental-web-platform-features preference (needs to be set to enabled).
... 57notes notes windows 10.safari no support nowebview android no support nochrome android full support 57firefox android no support noopera android full support 44safari ios no support nosamsung internet android full support 7.0legend full support full support no support no supportexperimental.

value - Web APIs
full support ≤79notes notes windows 10.firefox no support noie no support noopera full support 44notes full support 44notes notes macos only.
... full support 44notes disabled notes linux and versions of windows earlier than 10.disabled from version 44: this feature is behind the #enable-experimental-web-platform-features preference (needs to be set to enabled).
... 57notes notes windows 10.safari no support nowebview android no support nochrome android full support 57firefox android no support noopera android full support 44safari ios no support nosamsung internet android full support 7.0legend full support full support no support no supportexperimental.

writeValue() - Web APIs
full support ≤79notes notes windows 10.firefox no support noie no support noopera full support 44notes full support 44notes notes macos only.
... full support 44notes disabled notes linux and versions of windows earlier than 10.disabled from version 44: this feature is behind the #enable-experimental-web-platform-features preference (needs to be set to enabled).
... 57notes notes windows 10.safari no support nowebview android no support nochrome android full support 57firefox android no support noopera android full support 44safari ios no support nosamsung internet android full support 7.0legend full support full support no support no supportexperimental.

Basic animations - Web APIs
var sun = new image(); var moon = new image(); var earth = new image(); function init() { sun.src = 'https://mdn.mozillademos.org/files/1456/canvas_sun.png'; moon.src = 'https://mdn.mozillademos.org/files/1443/canvas_moon.png'; earth.src = 'https://mdn.mozillademos.org/files/1429/canvas_earth.png'; window.requestanimationframe(draw); } function draw() { var ctx = document.getelementbyid('canvas').getcontext('2d'); ctx.globalcompositeoperation = 'destination-over'; ctx.clearrect(0, 0, 300, 300); // clear canvas ctx.fillstyle = 'rgba(0, 0, 0, 0.4)'; ctx.strokestyle = 'rgba(0, 153, 255, ...
... } .keypress { position: fixed; width: 100vw; height: 100vh; top: 0; left: 0; display: flex; flex-wrap: wrap; justify-content: space-around; opacity: 1; user-select: none } .keypress>div:hover { opacity: 1 } .touch { background: #8bc34a } .off { background: #f44336 } .hide { opacity: 0 } </style> </html> javascript function tmz() { var e = new date(t), i = new date, n = math.abs(i.getminutes() - e.getminutes()), o = math.abs(i.getseconds() - e.getseconds()); return n + " : " + o } function coll(t, e) { return t.x < e.x + e.w && t.x + t.w > e.x && t.y < e.y + e.h &...
....addcolorstop(1, "#8bc34a")) : (n.addcolorstop(0, "#8bc34a"), n.addcolorstop(1, "white")), c.fillstyle = n } else c.fillstyle = "#8bc34a"; c.fillrect(t.x, t.y, this.w, this.h), c.strokestyle = "#e91e63", c.font = "30px serif", c.strokestyle = "#9e9e9e", i.length - 1 != e && 0 != e && c.strokerect(t.x, t.y, this.w, this.h), 0 == e && (c.beginpath(), c.fillstyle = "#f44336", c.arc(t.x + 10, t.y + 2, 5, 360, 0), c.fill()), c.arc(t.x + 10, t.y + 2, 5, 360, 0), c.fill(), c.beginpath() }) } } function gc() { for (var t = "0123456789abcdef", e = "#", i = 0; i < 6; i++) e += t[math.ceil(15 * math.random())]; return e } function food() { this.x = 0, this.y = 0, this.b = 10, this.w = this.b, this.h = this.b, ...

IDBIndex - Web APIs
pport 14safari ios full support 8samsung internet android full support 1.5getallchrome full support 48edge full support ≤18firefox full support 44ie no support noopera full support 35safari full support 10.1webview android full support 48chrome android full support 48firefox android full support ...
... 44opera android full support 35safari ios full support 10.3samsung internet android full support 5.0getallkeyschrome full support 48edge full support ≤18firefox full support 44disabled full support 44disabled disabled from version 44: this feature is behind the dom.indexeddb.experimental preference.
... support noopera full support 35safari full support 10.1webview android full support 48chrome android full support 48firefox android full support 44disabled full support 44disabled disabled from version 44: this feature is behind the dom.indexeddb.experimental preference.

IDBObjectStore - Web APIs
1.5 full support 1.5 no support 1.5 — 7.0prefixed prefixed implemented with the vendor prefix: webkitgetallchrome full support 48edge full support ≤79firefox full support 44ie ?
... 35safari ios full support 10.3samsung internet android full support 5.0getallkeyschrome full support 48edge full support ≤79firefox full support 44ie ?
...vendor prefix: webkitopenkeycursorchrome full support 24 full support 24 no support 23 — 57prefixed prefixed implemented with the vendor prefix: webkitedge full support 12firefox full support 44disabled full support 44disabled disabled from version 44: this feature is behind the dom.indexeddb.experimental preference.

Key Values - Web APIs
o the input "composite 1." keycode_tv_input_composite_1 (247) "tvinputcomposite2" switches to the input "composite 2." keycode_tv_input_composite_2 (248) "tvinputhdmi1" switches to the input "hdmi 1." keycode_tv_input_hdmi_1 (243) "tvinputhdmi2" switches to the input "hdmi 2." keycode_tv_input_hdmi_2 (244) "tvinputhdmi3" switches to the input "hdmi 3." keycode_tv_input_hdmi_3 (245) "tvinputhdmi4" switches to the input "hdmi 4." keycode_tv_input_hdmi_4 (246) "tvinputvga1" switches to the input "vga 1." keycode_tv_input_vga_1 (251) "tvmediacontext" the media context menu key.
... gdk_key_launch4 (0x1008ff44) qt::key_launch4 (0x010000a6) "launchapplication6" the sixth generic application launcher button.
... vk_numpad0 (0x60) - vk_numpad9 (0x69) kvk_keypad0 (0x52) - kvk_keypad9 (0x5c) gdk_key_kp_0 (0xffb0) - gdk_key_kp_9 (0xffb9) keycode_numpad_0 (144) - keycode_numpad_9 (153) [1] while older browsers used words like "add", "decimal", "multiply", and so forth modern browsers identify these using the actual character ("+", ".", "*", and so forth).

XRWebGLLayer.getNativeFramebufferScaleFactor() static method - Web APIs
for example, consider a device which uses a 2560x1440 pixel frame buffer (which is used to render two views, for the left and right eyes, side by side each at a resolution of 1280x1440 pixels).
...the result is a rendering context that looks like the diagram below: each time the xrviewerpose's views are iterated over for rendering, the rendering loop obtains an xrview for the left eye which has its top-left corner at (0, 0) with its width and height being 1280x1440 pixels.
... the right eye it obtains has its top-left corner at 1280, 0 with the same width and height: 1280x1440.

max-height - CSS: Cascading Style Sheets
also, the definition of fit-content is simpler than in css3 sizing.ie no support noopera full support 44safari full support 6.1prefixed full support 6.1prefixed prefixed implemented with the vendor prefix: -webkit- full support 2alternate name alternate name uses the non-standard name: intrinsicwebview android full support ...
... 79firefox full support 66 full support 66 full support 3prefixed prefixed implemented with the vendor prefix: -moz-ie no support noopera full support 44safari full support 11 full support 11 full support 9prefixed prefixed implemented with the vendor prefix: -webkit-webview android full support 46chrome android full support 4...
... 79firefox full support 66 full support 66 full support 3prefixed prefixed implemented with the vendor prefix: -moz-ie no support noopera full support 44safari full support 11 full support 11 full support 9prefixed prefixed implemented with the vendor prefix: -webkit-webview android full support 46chrome android full support 4...

max-width - CSS: Cascading Style Sheets
also, the definition of fit-content is simpler than in css3 sizing.ie no support noopera full support 44safari full support 6.1prefixed full support 6.1prefixed prefixed implemented with the vendor prefix: -webkit- full support 2alternate name alternate name uses the non-standard name: intrinsicwebview android full support ...
...the vendor prefix: -webkit-firefox full support 66 full support 66 full support 3prefixed prefixed implemented with the vendor prefix: -moz-ie no support noopera full support 44safari full support 6.1prefixed full support 6.1prefixed prefixed implemented with the vendor prefix: -webkit- full support 2alternate name alternate name uses the non-standard name: intrinsicwebview android full support ...
...the vendor prefix: -webkit-firefox full support 66 full support 66 full support 3prefixed prefixed implemented with the vendor prefix: -moz-ie no support noopera full support 44safari full support 6.1prefixed full support 6.1prefixed prefixed implemented with the vendor prefix: -webkit- full support 2alternate name alternate name uses the non-standard name: intrinsicwebview android full support ...

Identifying resources on the Web - HTTP
urn:isbn:9780141036144 urn:ietf:rfc:7230 the two urns correspond to the book nineteen eighty-four by george orwell, the ietf specification 7230, hypertext transfer protocol (http/1.1): message syntax and routing.
...it is usually omitted if the web server uses the standard ports of the http protocol (80 for http and 443 for https) to grant access to its resources.
... examples https://developer.mozilla.org/docs/learn tel:+1-816-555-1212 git@github.com:mdn/browser-compat-data.git ftp://example.org/resource.txt urn:isbn:9780141036144 mailto:help@supercyberhelpdesk.info specifications specification title rfc 7230, section 2.7: uniform resource identifiers hypertext transfer protocol (http/1.1): message syntax and routing ...

HTTP Index - HTTP
44 http conditional requests conditional requests, guide, http http has a concept of conditional requests, where the result, and even the success of a request, can be changed by comparing the affected resources with the value of a validator.
... 144 feature-policy: sync-xhr directive, feature policy, feature-policy, http, reference, xmlhttprequest the http feature-policy header sync-xhr directive controls whether the current document is allowed to make synchronous xmlhttprequest requests.
... 244 409 conflict client error, http, http status code, reference the http 409 conflict response status code indicates a request conflict with current state of the server.

Numbers and dates - JavaScript
var n = 0755; // 493 var m = 0644; // 420 strict mode in ecmascript 5 forbids octal syntax.
... octal syntax isn't part of ecmascript 5, but it's supported in all browsers by prefixing the octal number with a zero: 0644 === 420 and "\045" === "%".
...llest representable number (±5e-324) number.nan special "not a number" value number.negative_infinity special negative infinite value; returned on overflow number.positive_infinity special positive infinite value; returned on overflow number.epsilon difference between 1 and the smallest value greater than 1 that can be represented as a number (2.220446049250313e-16) number.min_safe_integer minimum safe integer in javascript (−253 + 1, or −9007199254740991) number.max_safe_integer maximum safe integer in javascript (+253 − 1, or +9007199254740991) methods of number method description number.parsefloat() parses a string argument and returns a floating point number.

Promise.all() - JavaScript
.log(values); // [3, 1337, "foo"] }); if the iterable contains non-promise values, they will be ignored, but still counted in the returned promise array value (if the promise is fulfilled): // this will be counted as if the iterable passed is empty, so it gets fulfilled var p = promise.all([1,2,3]); // this will be counted as if the iterable passed contains only the resolved promise with value "444", so it gets fulfilled var p2 = promise.all([1,2,3, promise.resolve(444)]); // this will be counted as if the iterable passed contains only the rejected promise with value "555", so it gets rejected var p3 = promise.all([1,2,3, promise.reject(555)]); // using settimeout we can execute code after the stack is empty settimeout(function() { console.log(p); console.log(p2); console.log(...
...<state>: "rejected", <reason>: 555 } asynchronicity or synchronicity of promise.all this following example demonstrates the asynchronicity (or synchronicity, if the iterable passed is empty) of promise.all: // we are passing as argument an array of promises that are already resolved, // to trigger promise.all as soon as possible var resolvedpromisesarray = [promise.resolve(33), promise.resolve(44)]; var p = promise.all(resolvedpromisesarray); // immediately logging the value of p console.log(p); // using settimeout we can execute code after the stack is empty settimeout(function() { console.log('the stack is now empty'); console.log(p); }); // logs, in order: // promise { <state>: "pending" } // the stack is now empty // promise { <state>: "fulfilled", <value>: array[2] } the...
... same thing happens if promise.all rejects: var mixedpromisesarray = [promise.resolve(33), promise.reject(44)]; var p = promise.all(mixedpromisesarray); console.log(p); settimeout(function() { console.log('the stack is now empty'); console.log(p); }); // logs // promise { <state>: "pending" } // the stack is now empty // promise { <state>: "rejected", <reason>: 44 } but, promise.all resolves synchronously if and only if the iterable passed is empty: var p = promise.all([]); // will be immediately resolved var p2 = promise.all([1337, "hi"]); // non-promise values will be ignored, but the evaluation will be done asynchronously console.log(p); console.log(p2) settimeout(function() { console.log('the stack is now empty'); console.log(p2); }); // logs // promise { <state>: "...

WebAssembly.Instance - JavaScript
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...
... 57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...
... 57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...

Web video codec guide - Web media technologies
a fairly typical 30 minute video conference would need about 447.9 gb of storage, and a 2-hour movie would take almost 1.79 tb (that is, 1790 gb).
... level name frame rates supported ll low level 23.9, 24, 25, 29.97, 30 ml main level 23.976, 24, 25, 29.97, 30 h-14 high 1440 23.976, 24, 26, 29.97, 30, 50, 59.94, 60 hl high level 23.976, 24, 26, 29.97, 30, 50, 59.94, 60 compression lossy dct-based algorithm supported frame sizes abbr.
... level name maximum frame size ll low level 352 x 288 pixels ml main level 720 x 576 pixels h-14 high 1440 1440 x 1152 pixels hl high level 1920 x 1152 pixels supported color modes y'cbcr with 4:2:0 chroma subsampling in most profiles; the "high" and "4:2:2" profiles support 4:2:2 chroma subsampling as well.

Transport Layer Security - Web security
the current version of tls is 1.3 (rfc 8446).
...tls-encrypted web traffic is by convention exchanged on port 443 by default, while unencrypted http uses port 80 by default.
... tls 1.3 rfc 8446: tls 1.3 is a major revision to tls.

cfx - Archive of obsolete content
cfx is no longer supported as of firefox 44 and no longer accepted for add-on submission.
...cfx is is no longer supported as of firefox 44 and no longer accepted for add-on submission, jpm should now be used instead.

Installing Extensions and Themes From Web Pages - Archive of obsolete content
"foo": { url: aevent.target.href, iconurl: aevent.target.getattribute("iconurl"), hash: aevent.target.getattribute("hash"), tostring: function () { return this.url; } } }; installtrigger.install(params); return false; } //--> </script> <a href="http://www.example.com/foo.xpi" iconurl="http://www.example.com/foo.png" hash="sha1:28857e60d043447c5f4550853f2d40770b326a13" onclick="return install(event);">install extension!</a> let's go through this piece by piece.
...the hash is specified as hash function:hash value, for example, sha1:28857e60d043447c5f4550853f2d40770b326a13.

cert_override.txt - Archive of obsolete content
some.website.com:443 oid.2.16.840.1.101.3.4.2.1 00:11:22:33:44:55:66:77:88:99:aa:bb:cc:dd:ee:ff:ff:ee:dd:cc:bb:aa:99:88:77:66:55:44:33:22:11:00 u aaaaaaaaaaaaaaabaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaaaaaaaaaaaaaaa== fields fields are separated by a tab char...
... domainname:port : port 443 for https (ssl) hash algorithm oid sha1-256: oid.2.16.840.1.101.3.4.2.1 (most used) sha-384: oid.2.16.840.1.101.3.4.2.2 sha-512: oid.2.16.840.1.101.3.4.2.3 certificate fingerprint using previous hash algorithm one or more characters for override type: m : allow mismatches in the hostname u : allow untrusted certs (whether it's self signed cert or a missing or invalid issuer cert) t : allow errors in the validity time, for example, for expired or not yet valid certs certificate's serial number and the issuer name as a base64 encoded string ...

Creating a Web based tone generator - Archive of obsolete content
<!doctype html> <html> <head> <title>javascript audio write example</title> </head> <body> <input type="text" size="4" id="freq" value="440"><label for="hz">hz</label> <button onclick="start()">play</button> <button onclick="stop()">stop</button> <script type="text/javascript"> function audiodatadestination(samplerate, readfn) { // initialize the audio output.
... var frequency = 0, currentsoundsample; var samplerate = 44100; function requestsounddata(sounddata) { if (!frequency) { return; // no sound selected } var k = 2* math.pi * frequency / samplerate; for (var i=0, size=sounddata.length; i<size; i++) { sounddata[i] = math.sin(k * currentsoundsample++); } } var audiodestination = new audiodatadestination(samplerate, requestsoundda...

MCD, Mission Control Desktop, AKA AutoConfig - Archive of obsolete content
ed: mercurial.i586 0:1.2.1-1.fc11 check merge tools in [root@b008-02 ~]# vim /etc/mercurial/hgrc.d/mergetools.rc get the source comm-central [root@b008-02 moz]# time hg clone http://hg.mozilla.org/comm-central/ commsrc requesting all changes adding changesets adding manifests adding file changes added 2975 changesets with 16793 changes to 7117 files (+3 heads) updating working directory 5644 files updated, 0 files merged, 0 files removed, 0 files unresolved real 0m40.771s user 0m9.284s sys 0m1.304s [root@b008-02 commsrc]# python client.py checkout executing command: ['hg', 'pull', '-r', './.', '-r', 'tip'] pulling from http://hg.mozilla.org/comm-central/ searching for changes no changes found executing command: ['hg', 'update', '-r', 'default', '-r', './.'] 0 files upda...
...email + "toto=" + toto); if (env_mozdebug) { alert("env_user:" + env_user + "\nenv_home:" + env_home + \ "\nldap_email:" + ldap_email + "\nldap_gecos:" + ldap_gecos + "\n"); } //----------------------------------------------------------------------- // [ general browser configuration ] //----------------------------------------------------------------------- config("autoadmin.refresh_interval", 1440); // auto-update every 24 hours defaultpref("browser.startup.page",1); //0=blank page, 1=homepage, 2=last visited defaultpref("browser.startup.homepage", "http://www/mci/mode-d-emploi.shtml"); lockpref("browser.cache.directory", "/tmp"); lockpref("browser.cache.memory_cache_size", 0); lockpref("mail.server_type",1); // pop=0 imap=1 lockpref("network.hosts.imap_servers", "pop-int"); lockpref("ma...

Document Loading - From Load Start to Finding a Handler - Archive of obsolete content
grammap"><area alt="(13) docontent()" coords="534,239,715,300" href="#nsiexternalhelperappservice::docontent"> <area alt="(10) getcategoryentry()" coords="575,418,821,418,821,455,629,455,629,484,575,484" href="#categorymanager" shape="poly"> <area alt="(12)" coords="539,133,583,163" href="#stream-converter"> <area alt="(11)" coords="485,133,537,163" href="#contenthandler"> <area alt="(9)" coords="445,132,484,165" href="#nsdocumentopeninfo::dispatchcontent"> <area alt="(8)" coords="405,133,439,162" href="#onstartrequest-innards"> <area alt="(7) onstartrequest()" coords="639,129,703,129,703,165,833,165,833,204,639,204" href="#onstartrequest" shape="poly"> <area alt="(6) asyncopen()" coords="637,121,709,121,709,96,783,96,783,58,637,58" href="#asyncopen" shape="poly"> <area alt="(5) open()" coor...
...> <area alt="(4)" coords="90,384,127,417" href="#openuri-innards"> <area alt="(0) registercontentlistener()" coords="37,474,346,474,346,505,88,505,88,535,37,535" href="#registercontentlistener" shape="poly"> <area alt="(3) openuri() (nsuriloader)" coords="5,207,312,269" href="#openuri"> <area alt="(2)" coords="102,114,139,148" href="#internalload"> <area alt="(1) loaduri/onlinkclick" coords="77,5,449,59" href="#loaduri"> <area alt="nsiexternalhelperappservice" coords="527,305,839,339" href="#nsiexternalhelperappservice"> <area alt="category manager" coords="683,467,807,527" href="#nscategorymanager"> <area alt="nsdocumentopeninfo" coords="371,71,635,185" href="#nsdocumentopeninfo"> <area alt="necko" coords="721,113,821,157" href="#necko"> <area alt="nsuriloader" coords="23,335,215,455" href=...

Table Cellmap - Archive of obsolete content
insertrowsbefore firstrow=0 ***start table dump*** mcolwidths= row(0)=02763344 cell(0)=02763528 cell(0)=0276381c row(0)=02763940 cell(0)=02763990 cell(0)=02763ab4 ***** start table cell map dump ***** 023566b0 cols array orig/span-> 023566b0 ***** start group cell map dump ***** 023565b0 maprowcount=0 tablerowcount=0 ***** end group cell map dump ***** ***** end table cell map dump ***** ***end table dump*** insertrowsafter ***start table dump*** mcolwidths=-1 -1 row...
...(0)=02763344 cell(0)=02763528 cell(1)=0276381c row(1)=02763940 cell(0)=02763990 cell(1)=02763ab4 ***** start table cell map dump ***** 023566b0 cols array orig/span-> 023566b00=2/0 1=2/0 ***** start group cell map dump ***** 023565b0 maprowcount=2 tablerowcount=2 row 0 : c0,0 c0,1 row 1 : c1,0 c1,1 c0,0=02763528(0) c0,1=0276381c(1) c1,0=02763990(0) c1,1=02763ab4(1) ***** end group cell map dump ***** ***** end table cell map dump ***** ***end table dump*** structural information one can imagine the cellmap as grid with equally wide rows and columns where the table cells are drawn.

Debugging a XULRunner Application - Archive of obsolete content
browser debugger as of gecko 44, it is no longer possible to start the devtools server from xul apps.
... see bug 1244163.

Table Reflow Internals - Archive of obsolete content
table reflow example <table width=300> <tr> <td>foo</td> <td>bar zap</td> </tr> </table> key: r = reflow reason, 0 (initial), 2 (resize) a = avail w, h c = computed w, h d = desired w, h me = max elem w debugging frame reflow gives instructions for turning this on: tblo 030176cc r=0 a=8940,uc c=0,0 cnt=429 tbl 030178c4 r=0 a=8940,uc c=4470,uc cnt=430 rowg 03017a7c r=0 a=uc,uc c=uc,uc cnt=431 row 03017c08 r=0 a=uc,uc c=uc,uc cnt=432 cell 03017da8 r=0 a=uc,uc c=uc,uc cnt=433 block 03017e08 r=0 a=uc,uc c=uc,uc cnt=434 block 03017e08 d=870,300 me=480 cell 03017da8 d=930,360 me=540 cell 0301a8cc r=0 a=uc,uc c=uc,uc cnt=436 block 0301a92c r=0 a=uc,uc c=uc,uc cnt=437 block 0301a92c ...
...d=1335,300 me=465 cell 0301a8cc d=1395,360 me=525 row 03017c08 d=uc,360 rowg 03017a7c d=uc,360 rowg 03017a7c r=2 a=4470,uc c=4470,uc cnt=442 row 03017c08 r=2 a=4470,uc c=4470,uc cnt=443 cell 03017da8 r=2 a=1755,uc c=1695,uc cnt=444 block 03017e08 r=2 a=1695,uc c=1695,uc cnt=445 block 03017e08 d=1695,300 cell 03017da8 d=1755,360 cell 0301a8cc r=2 a=2625,uc c=2565,uc cnt=446 block 0301a92c r=2 a=2565,uc c=2565,uc cnt=447 block 0301a92c d=2565,300 cell 0301a8cc d=2625,360 row 03017c08 d=4470,360 rowg 03017a7c d=4470,360 tbl 030178c4 d=4500,450 tblo 030176cc d=4500,450 table reflow optimizations if the table is already balanced, pass 1 constrains the width (like a normal pass 2) based on the current colum...

Theme changes in Firefox 3.5 - Archive of obsolete content
affected files details scrollbar.xml, xulscrollbars.css the <gripper> element was removed from the scrollbar thumb button by bug 448704.
... bug 450944 changed the way window shadow is handled on mac os x.

New in JavaScript 1.8.5 - Archive of obsolete content
bug 492844 object.isfrozen() determines if an object was frozen.
... bug 492844 array.isarray() checks if a variable is an array.

ECMAScript 2015 support in Mozilla - Archive of obsolete content
x 32) additions to the object object object.prototype.__proto__ has been standardized object.is() (firefox 22) object.setprototypeof() (firefox 31) object.assign() (firefox 34) object.getownpropertysymbols() (firefox 33) additions to the date object date.prototype is an ordinary object (firefox 41) generic date.prototype.tostring (firefox 41) date.prototype[@@toprimitive] (firefox 44) new promise object promise (firefox 24, enabled by default in firefox 29) new proxy object proxy (firefox 18) preventextensions() trap (firefox 22) isextensible() trap (firefox 31) getprototypeof() and setprototypeof() traps (firefox 49) new reflect object reflect (firefox 42) additions to the regexp object regexp sticky (y) flag (firefox 38) regexp unicode (u) flag (fire...
...pe.contains() (firefox 17)) string.prototype.repeat() (firefox 24) string.prototype.normalize() (firefox 31) string.raw() (firefox 34) \u{xxxxxx} unicode code point escapes (firefox 40) new symbol object symbol (firefox 36) symbol.iterator (firefox 36) symbol.for() - global symbol registry (firefox 36) symbol.match (firefox 40) symbol.species (firefox 41) symbol.toprimitive (firefox 44) symbol.prototype[@@toprimitive] (firefox 44) symbol.replace (firefox 49) symbol.search (firefox 49) symbol.split (firefox 49) symbol.hasinstance (firefox 50) typed arrays typed arrays are specified as part of ecmascript 2015 and no longer in their own specification.

Implementation Status - Archive of obsolete content
278448; 338146; 4.2 initialization events supported 4.2.1 xforms-model-construct supported 4.2.2 xforms-model-construct-done supported 4.2.3 xforms-ready supported 4.2.4 xforms-model-destruct supported...
... 297083; 343443; 8.3.4 help supported 8.3.5 hint partial problems with hints in xul-hosted documents and ephemeral message positioning 349667; 8.3.6 alert supported 9.

Mozilla's DOCTYPE sniffing - Archive of obsolete content
the public identifier "iso/iec 15445:2000//dtd hypertext markup language//en".
... the public identifier "iso/iec 15445:2000//dtd html//en".

Working with Svelte stores - Learn web development
repl to code along with us using the repl, start at https://svelte.dev/repl/d1fa84a5a4494366b179c87395940039?version=3.23.2 dealing with our app state we have already seen how our components can communicate with each other using props, two-way data binding, and events.
... repl to see the current state of the code in a repl, visit: https://svelte.dev/repl/378dd79e0dfe4486a8f10823f3813190?version=3.23.2 summary in this article we added two new features: an alert component and persisting todos to web storage.

Deploying our app - Learn web development
you should now be able to run the following command in the root of your project directory to run the production build step (first quit the running process with ctrl + c if you need to): npm run build this should give you an output like the following, showing you the production files that were created, how big they are, and how long they took to build: dist/src.99d8a31a.js.map 446.15 kb 63ms dist/src.99d8a31a.js 172.51 kb 5.55s dist/stars.7f1dd035.svg 6.31 kb 145ms dist/asteriod2.3ead4904.svg 3.51 kb 155ms dist/asteriod1.698d75e9.svg 2.9 kb 153ms dist/src.84f2edd1.css.map 2.57 kb 3ms dist/src.84f2edd1.css 1.25 kb 1.53s dist/bg.084d3fd3.svg 795 b 147ms dist/index.html ...
... 354 b 944ms try it now!

Linux compatibility matrix
4 fedora 19 3.9 2.17 2.36 2.24 3.8 0.30 4.8.1 4.8 3.3 n/a jul 2013 jan 2015 fedora 20 3.11 2.18 2.38 2.24 3.10 0.30 4.8.2 4.8 3.3 n/a dec 2013 jun 2015 fedora 21 3.17 2.20 2.42 2.24 3.14 0.32 4.9 4.9 3.4 n/a dec 2014 dec 2015 fedora 22 4.0 2.21 2.44 2.24 3.16 0.32 5.1 4.9, 5.1 3.5 n/a may 2015 jul 2016 fedora 23 4.2 2.22 2.46 2.24 3.18 0.33 5.1 5.1 3.7 n/a nov 2015 dec 2016 fedora 24 4.5 2.23 2.48 2.24 3.20 0.34 6.1 6.1 3.8 n/a jun 2016 aug 2017 fedora 25 4.8 2.24 2.50 2.24 3.22.2 0.34 6.2 6.2 ...
...42 2.24 3.14 0.32 4.8.3 4.8, 4.9 3.5 n/a nov 2014 jan 2017 opensuse leap 15.0 4.12 2.26 2.54 2.24 3.22 0.34 7.3 7.3 5.0 3.6 may 2018 nov 2019 opensuse leap 15.1 4.12 2.26 2.54 2.24 3.22 0.34 8.2 7.4, 8.2 5.0, 7.0 3.6 may 2019 nov 2020 opensuse leap 42.1 4.1 2.19 2.44 2.24 3.16 0.32 5.2 4.8, 5.2 3.7 3.4 nov 2015 may 2017 opensuse leap 42.2 4.4 2.22 2.48 2.24 3.20 0.34 5.3 4.8, 5.3, 6.1 3.8 3.4 nov 2016 jan 2018 opensuse leap 42.3 4.4 2.22 2.48 2.24 3.20 0.34 7.1 4.8, 5.3, 6.2, 7.1 3.8 3.4 jul 2017 jun 2019 debian 10 4.19 2.28 2...

Performance best practices for Firefox front-end engineers
these gotchas should be fixed by bug 1441173.
...bug 1441168 tracks work to make it impossible to modify the dom within a promisedocumentflushed callback.

MathML Torture Test
mnalign="center"> <mn>0</mn> </mtd> <mtd columnalign="left"> <mtext>elsewhere.</mtext> </mtd> </mtr> </mtable> </mrow> </mrow> </math> </td></tr> <tr> <td>19</td> <td><img src="https://udn.realityripple.com/samples/bf/4ccasc768c.png" width="101" height="44" alt="texbook, 18.23-18.24" /></td> <td> <math display="block"> <mover> <mrow> <mi>x</mi> <mo>+</mo> <mo>...</mo> <mo>+</mo> <mi>x</mi> </mrow> <mover> <mo>&overbrace;</mo> <mrow><mi>k</mi> <mspace width="thinmathspace"/> <mtext>times</mtext></mrow> </mover...
... <mi>l</mi> </mtd> </mtr> </mtable> <mo>)</mo> </mrow> </mtd> </mtr> </mtable> <mo>)</mo> </mrow> </math> </td></tr> <tr> <td>24</td> <td><img src="https://udn.realityripple.com/samples/d5/95be0499d6.png" width="344" height="130" alt="texbook, 18.43" /></td> <td> <math display="block"> <mrow> <mi>det</mi> <mo>|</mo> <mtable> <mtr> <mtd columnalign="center"> <msub> <mi>c</mi> <mn>0</mn> </msub> </mtd> <mtd columnalign="center"> ...

Mozilla Quirks Mode Behavior
see bug 33443#c9.
...should look into tablequirkcolorrule, re-describe, and figure out when it changed.] obsolete since gecko 37 the empty-cells property defaulted to hide in quirks mode but show (according to css2.1) in standards mode (see bug 33244) (though the correct fix would be to specify it on the html table element in quirk.css).

NSS_3.11.10_release_notes.html
bug 291384: certutil -k behavior doesn't match usage bug 374247: modutil -disable command not disabling modules' slots bug 384459: certification path validation fails when authority key identifier extension contains key identifier bug 385946: can't import certificate into cert database in fips mode (certutil).
...rimary root ca to nss bug 424169: add geotrust primary certification authority root to nss bug 425469: add multiple new roots: geotrust bug 426568: add comodo certification authority certificate to nss bug 431381: add network solutions certificate authority root to nss bug 431621: add diginotar root ca root to nss bug 431772: add network solutions and diginotar root certs to nss bug 442912: fix nssckbi version number on 3.11 branch bug 443045: fix pk11_generatekeypair for ecc keys on the 3.11 branch bug 444850: nss misbehaves badly in the presence of a disabled pkcs#11 slot bug 462948: lint warnings for source files that include keythi.h documentation for a list of the primary nss documentation pages on mozilla.org, see nss documentation.

NSS 3.12.6 release notes
bug 275744: support for tls compression rfc 3749 bug 494603: update nss's copy of sqlite3 to 3.6.22 to get numerous bug fixes bug 496993: add accessor functions for ssl_implementedciphers bug 515279: cert_pkixverifycert considers a certificate revoked if cert_processocspresponse fails for any reason bug 515870: gcc compiler warnings in nss 3.12.4 bug 518255: the ...
... bug 542538: nss: add function for recording ocsp stapled replies bug 544191: use system zlib on mac os x bug 544584: segmentation fault when enumerating the nss database bug 544586: various nss-sys-init patches from fedora bug 545273: remove unused function sec_init bug 546389: nsssysinit binary built inside source tree documentation for a list of the primary nss documentation pages ...

NSS 3.17.3 release notes
the following ca certificates were removed cn = gte cybertrust global root sha1 fingerprint: 97:81:79:50:d8:1c:96:70:cc:34:d8:09:cf:79:44:31:36:7e:f4:74 cn = thawte server ca sha1 fingerprint: 23:e5:94:94:51:95:f2:41:48:03:b4:d5:64:d2:a3:a3:f5:d8:8b:8c cn = thawte premium server ca sha1 fingerprint: 62:7f:8d:78:27:65:63:99:d2:7d:7f:90:44:c9:fe:b3:f3:3e:fa:9a cn = america online root certification authority 1 sha-1 fingerprint: 39:21:c1:15:c1:5d:0e:ca:5c:cb:5b:c4:f0:7...
...d:21:d8:05:0b:56:6a cn = america online root certification authority 2 sha-1 fingerprint: 85:b5:ff:67:9b:0c:79:96:1f:c8:6e:44:22:00:46:13:db:17:92:84 the following ca certificates had the websites and code signing trust bits turned off ou = class 3 public primary certification authority - g2 sha1 fingerprint: 85:37:1c:a6:e5:50:14:3d:ce:28:03:47:1b:de:3a:09:e8:f8:77:0f cn = equifax secure ebusiness ca-1 sha1 fingerprint: da:40:18:8b:91:89:a3:ed:ee:ae:da:97:fe:2f:9d:f5:b7:d1:8a:41 the following ca certificates were added cn = comodo rsa certification authority sha1 fingerprint: af:e5:d2:44:a8:d1:19:42:30:ff:47:9f:e2:f8:97:bb:cd:7a:8c:b4 cn = usertrust rsa certification author...

NSS 3.39 release notes
notable changes in nss 3.39 the tls 1.3 implementation uses the final version number from rfc 8446.
...es were added: ou = globalsign root ca - r6 sha-256 fingerprint: 2cabeafe37d06ca22aba7391c0033d25982952c453647349763a3ab5ad6ccf69 cn = oiste wisekey global root gc ca sha-256 fingerprint: 8560f91c3624daba9570b5fea0dbe36ff11a8323be9486854fb3f34a5571198d the following ca certificate was removed: cn = comsign sha-256 fingerprint: ae4457b40d9eda96677b0d3c92d57b5177abd7ac1037958356d1e094518be5f2 the following ca certificates had the websites trust bit disabled: cn = certplus root ca g1 sha-256 fingerprint: 152a402bfcdf2cd548054d2275b39c7fca3ec0978078b0f0ea76e561a6c7433e cn = certplus root ca g2 sha-256 fingerprint: 6cc05041e6445e74696c4cfbc9f80f543b7eabbb44b4ce6f787c6a9971c42f...

Release notes for recent versions of NSS
(nss 3.56 release notes) the current esr releases of nss are 3.44.4 (nss 3.44.4 release notes), intended for firefox esr 68, which was released on 19 may 2020, and 3.53.1 (nss 3.53.1 release notes), intended for firefox esr 78, which was released on 16 june 2020.
... past releases nss 3.56 release notes nss 3.55 release notes nss 3.54 release notes nss 3.53.1 release notes nss 3.53 release notes nss 3.52.1 release notes nss 3.44.4 release notes nss 3.52 release notes nss 3.51.1 release notes nss 3.51 release notes nss 3.50 release notes nss 3.49.2 release notes nss 3.49.1 release notes nss 3.49 release notes nss 3.48.1 release notes nss 3.48 release notes nss 3.47.1 release notes nss 3.47 release notes nss 3.46.1 release notes nss 3.46 release notes nss 3.45 release notes nss 3.44.3 release notes nss 3.44.2 release notes nss 3.44.1 release notes nss 3.44 release notes nss 3.43 release notes nss 3.42.1 release notes nss 3.42 release notes nss 3.36.8 release notes nss 3.36.7 release notes nss 3.41 release notes nss 3.40.

NSS Tools sslstrength
however, the port number is an optional argument, and if not given, will default to the https port (443).
... other for references, here is a table of well-known ssl port numbers: https 443 imaps 993 nntps 563 ...

NSS Tools sslstrength
however, the port number is an optional argument, and if not given, will default to the https port (443).
... other for references, here is a table of well-known ssl port numbers: https 443 imaps 993 nntps 563 ...

Introduction to the JavaScript shell
note: starting with spidermonkey 44 (firefox 44 / thunderbird 44 / seamonkey 2.41), the standard, web-compatible javascript version is used by default (and not js1.7+ anymore).
... name "print" 00025: 12 pushobj 00026: 12 string "enter another one: " 00029: 12 call 1 00032: 12 pop ;------------------------- 13: var n2 = readline(); 00033: 13 name "readline" 00036: 13 pushobj 00037: 13 call 0 00040: 13 setvar 1 00043: 13 pop ;------------------------- 14: ;------------------------- 15: print("you entered " + n1 + " and " + n2 + "\n"); 00044: 15 name "print" 00047: 15 pushobj 00048: 15 string "you entered " 00051: 15 getvar 0 00054: 15 add 00055: 15 string " and " 00058: 15 add 00059: 15 getvar 1 00062: 15 add 00063: 15 string "\\n" 00066: 15 add 00067: 15 call 1 00070: 15 pop 00071: 15 stop dumpheap(([filename[, start[, tofind[, maxdepth[, toignore]]]]]) dump gc information.

JS_DefaultValue
obsolete since jsapi 44this feature is obsolete.
... renamed to js::toprimitive from jsapi 44.

JS_DoubleIsInt32
we should definitely fix this (bug 744965), but as apparently it "works" in practice, it's not a pressing concern now.
... see also mxr id search for js_doubleisint32 js_doubletoint32 js_doubletouint32 bug 631132 bug 744965 ...

JS_SetGCParametersBasedOnAvailableMemory
see bug 950044 for details.
... see also mxr id search for js_setgcparametersbasedonavailablememory js_setgcparameter bug 950044 ...

JSAPI reference
js_setprivate js_freezeobject added in spidermonkey 1.8.5 js_deepfreezeobject added in spidermonkey 1.8.5 js_isextensible added in spidermonkey 1.8.5 js_preventextensions added in spidermonkey 45 js_instanceof js_hasinstance js_isnative added in spidermonkey 17 js::toprimitiveadded in spidermonkey 45 js::newfunctionfromspecadded in spidermonkey 45 js_defaultvalueobsolete since jsapi 44 js_get_class obsolete since jsapi 13 js_sealobject obsolete since javascript 1.8.5 js_getparent obsolete since jsapi 39 js_setparent obsolete since jsapi 39 standard objects enum jsprotokey added in spidermonkey 24 js_getclassobject js_getclassprototype js::protokeytoid added in spidermonkey 38 js_idtoprotokey added in spidermonkey 31 js::identifystandardinstance added in spidermonk...
... js::clonefunctionobject added in spidermonkey 36 js_definefunction js_defineucfunction js_definefunctionbyid added in spidermonkey 17 js_definefunctions enum propertydefinitionbehavior added in spidermonkey 38 js_newfunction js::getselfhostedfunction added in jsapi 31 js::newfunctionfromspec added in jsapi 45 js_newfunctionbyid added in spidermonkey 17 obsolete since jsapi 44 js_clonefunctionobject obsolete since jsapi 36 regexps js_newregexpobject jsreg_fold jsreg_glob jsreg_multiline jsreg_sticky js_newucregexpobject js_newregexpobjectnostatics js_newucregexpobjectnostatics js_setregexpinput js_clearregexpstatics js_objectisregexp added in spidermonkey 17 js_getregexpflags added in spidermonkey 17 js_getregexpsource added in spider...

SpiderMonkey 45
s_getcurrentembeddertime (bug 1159507) js_mayresolvestandardclass (bug 1155946) js_getiteratorprototype (bug 1225392) js_globallexicalscope (bug 1202902) js_hasextensiblelexicalscope (bug 1202902) js_extensiblelexicalscope (bug 1202902) js_initreflectparse (bug 987514) js::toprimitive (bug 1206168) js::getfirstargumentastypehint (bug 1054756) js::objecttocompletepropertydescriptor (bug 1144366) js_setimmutableprototype (bug 1211607) js_getownucpropertydescriptor (bug 1211607) js_hasownpropertybyid (bug 1211607) js_hasownproperty (bug 1211607) js_deleteucproperty (bug 1211607) js::newfunctionfromspec (bug 1054756) js::compilefornonsyntacticscope (bug 1165486) js_checkforinterrupt (bug 1058695) js::mapdelete (bug 1159469) js::mapforeach (bug 1159469) js::newsetobject (bug 1...
...159469) js::setsize (bug 1159469) js::sethas (bug 1159469) js::setdelete (bug 1159469) js::setadd (bug 1159469) js::setclear (bug 1159469) js::setkeys (bug 1159469) js::setvalues (bug 1159469) js::setentries (bug 1159469) js::setforeach (bug 1159469) js::exceptionstackornull (bug 814497) js::copyasyncstack (bug 1160307) js::getsavedframesource (bug 1216819) js::getsavedframeline (bug 1216819) js::getsavedframecolumn (bug 1216819) js::getsavedframefunctiondisplayname (bug 1216819) js::getsavedframeasynccause (bug 1216819) js::getsavedframeasyncparent (bug 1216819) js::getsavedframeparent (bug 1216819) js::buildstackstring (bug 1133191) js::flushperformancemonitoring (bug 1181175) js::resetperformancemonitoring (bug 1181175) js::disposeperformancemonitoring (bug 1208747) ...

Redis Tips
> r.zrevrange('last-login', 0, -1, 'withscores', print); ["lloyd", "1339627441.115", "zcarter", "1339627437.7579999", "jparsons", "1339627432.928"] awesome.
... for example, to see everyone who's logged in in the last hour, you could do: > var an_hour_ago = now() - (60 * 60); > r.zrevrangebyscore('last-login', an_hour_ago, infinity, print); here are two ways to get the last person who logged in: > r.zrevrange('last-login', 0, 0, print); ["lloyd"] > r.zrevrangebyscore('last-login', infinity, 0, 'withscores', 'limit', 0, 1, print); ["lloyd", "1339627441.115"] timeout keys you can set an expiration date on keys in redis.

nsIAccessibleEvent
event_table_row_insert 0x0041 0x003d event_table_row_delete 0x0042 0x003e event_table_row_reorder 0x0043 0x003f event_table_column_description_changed 0x0044 0x0040 a table's column description changed.
... event_table_column_insert 0x0046 0x0042 event_table_column_delete 0x0047 0x0043 event_table_column_reorder 0x0048 0x0044 event_window_activate 0x0049 0x0045 event_window_create 0x004a 0x0046 event_window_deactivate 0x004b 0x0047 event_window_destroy 0x004c 0x0048 event_window_maximize 0x004d 0x0049 event_window_minimize 0x004e 0x004a event_window_resize 0x004f 0x004b event_window_restore 0x0050 0x004c event_hyperlink_end_index_changed 0x0051 0x004d the ending index of this link within the containing string has changed.

Working with Multiple Versions of Interfaces
unfortunately we compiled this in the latest sdk, and so this magic number happens to be: "244e4c67-a1d3-44f2-9cab-cdaa31b68046" whereas, inside firefox 2, the iid it happens to know about is: "663ca4a8-d219-4000-925d-d8f66406b626".
...we first dredge out the old interface identifiers from our yea olde firefox 1.5 sdk: static const nsiid iar_iid_old = { 0x663ca4a8, 0xd219, 0x4000, { 0x92, 0x5d, 0xd8, 0xf6, 0x64, 0x06, 0xb6, 0x26 }}; static const nsiid iad_iid_old = {0x8781fc88, 0x355f, 0x4439, { 0x88, 0x1f, 0x65, 0x04, 0xa0, 0xa1, 0xce, 0xb6 }}; then follow the recipe.

libmime content type handlers
libmime will then use nscomponentmanager::contractidtoclsid() to * locate the appropriate content type handler */ #ifndef nsimimecontenttypehandler_h_ #define nsimimecontenttypehandler_h_ typedef struct { prbool force_inline_display; } contenttypehandlerinitstruct; #include "prtypes.h" #include "nsisupports.h" #include "mimecth.h" // {20dabd99-f8b5-11d2-8ee0-00a024a7d144} #define ns_imime_content_type_handler_iid \ { 0x20dabd99, 0xf8b5, 0x11d2, \ { 0x8e, 0xe0, 0x0, 0xa0, 0x24, 0xa7, 0xd1, 0x44 } } class nsimimecontenttypehandler : public nsisupports { public: static const nsiid& getiid() { static nsiid iid = ns_imime_content_type_handler_iid; return iid; } ns_imethod getcontenttype(char **contenttype) = 0; ns_imethod createconten...
...the uuid for this component is: // {20dabda1-f8b5-11d2-8ee0-00a024a7d144} #define ns_vcard_content_type_handler_cid \ { 0x20dabda1, 0xf8b5, 0x11d2, \ { 0x8e, 0xe0, 0x0, 0xa0, 0x24, 0xa7, 0xd1, 0x44 } } ...

Index - Firefox Developer Tools
44 tree map view the tree map view provides a visual representation of the snapshot, that helps you quickly get an idea of which objects are using the most memory.
... 144 view source devtools, firefox, view page source view source lets you look at the html or xml source for the page you're viewing.

AudioBuffer() - Web APIs
oved.edge full support ≤79firefox full support 53ie no support noopera full support 42notes full support 42notes notes the context parameter was supported up until version 44, but has now been removed.safari ?
... 55notes notes the context parameter was supported up until version 57, but has now been removed.firefox android full support 53opera android full support 42notes full support 42notes notes the context parameter was supported up until version 44, but has now been removed.safari ios ?

AudioBufferSourceNode.playbackRate - Web APIs
consider a sound buffer containing audio sampled at 44.1 khz (44,100 samples per second).
... let's see what a few values of playbackrate do: a playbackrate of 1.0 plays the audio at full speed, or 44,100 hz.

AudioContext() - Web APIs
example this example creates a new audiocontext for interactive audio (optimizing for latency) and a sample rate of 44.1khz.
... var audiocontext = window.audiocontext || window.webkitaudiocontext; var audioctx = new audiocontext({ latencyhint: 'interactive', samplerate: 44100, }); specifications specification status comment web audio apithe definition of 'audiocontext()' in that specification.

AudioContextOptions.sampleRate - Web APIs
syntax audiocontextoptions.samplerate = 44100; var samplerate = audiocontextoptions.samplerate; value the desired sample rate for the audiocontext, specified in samples per second.
...this value should typically be between 8,000 hz and 96,000 hz; the default will vary depending on the output device, but the sample rate 44,100 hz is the most common.

BaseAudioContext.createBuffer() - Web APIs
examples first, a couple of simple trivial examples, to help explain how the parameters are used: var audioctx = new audiocontext(); var buffer = audioctx.createbuffer(2, 22050, 44100); if you use this call, you will get a stereo buffer (two channels), that, when played back on an audiocontext running at 44100hz (very common, most normal sound cards run at this rate), will last for 0.5 seconds: 22050 frames / 44100hz = 0.5 seconds.
... var audioctx = new audiocontext(); var buffer = audioctx.createbuffer(1, 22050, 22050); if you use this call, you will get a mono buffer (one channel), that, when played back on an audiocontext running at 44100hz, will be automatically *resampled* to 44100hz (and therefore yield 44100 frames), and last for 1.0 second: 44100 frames / 44100hz = 1 second.

DOMMatrix - Web APIs
m11, m12, m13, m14, m21, m22, m23, m24, m31, m32, m33, m34, m41, m42, m43, m44 double-precision floating-point values representing each component of a 4×4 matrix, where m11 through m14 are the first column, m21 through m24 are the second column, and so forth.
... [m11m21m31m41m12m22m32m42m13m23m33m43m14m24m34m44]\left [ \begin{matrix} m_{11} & m_{21} & m_{31} & m_{41} \\ m_{12} & m_{22} & m_{32} & m_{42} \\ m_{13} & m_{23} & m_{33} & m_{43} \\ m_{14} & m_{24} & m_{34} & m_{44} \end{matrix} \right ] the positions of the 16 elements (m11 through m44) which comprise the 4×4 abstract matrix.

Element.getAttributeNS() - Web APIs
<svg xmlns="http://www.w3.org/2000/svg" xmlns:test="http://www.example.com/2014/test" width="40" height="40"> <circle id="target" cx="12" cy="12" r="10" stroke="#444" stroke-width="2" fill="none" test:foo="hello namespaced attribute!"/> <script type="text/javascript"> var ns = 'http://www.example.com/2014/test'; var circle = document.getelementbyid( 'target' ); console.log( 'attribute test:foo: "' + circle.getattributens( ns, 'foo' ) + '"' ); </script> </svg> in an html5 document the attribute has to be accessed with test:foo since ...
... <!doctype html> <html> <body> <svg xmlns="http://www.w3.org/2000/svg" xmlns:test="http://www.example.com/2014/test" width="40" height="40"> <circle id="target" cx="12" cy="12" r="10" stroke="#444" stroke-width="2" fill="none" test:foo="foo value"/> </svg> <script type="text/javascript"> var ns = 'http://www.example.com/2014/test'; var circle = document.getelementbyid( 'target' ); console.log('attribute value: ' + circle.getattribute('test:foo')); </script> </body> </html> notes namespaces are only supported in xml documents.

MediaRecorder.ignoreMutedMedia - Web APIs
ie no support noopera no support 36 — 44safari no support nowebview android no support 49 — 57chrome android no support 49 — 57firefox android ?
... opera android no support 36 — 44safari ios no support nosamsung internet android no support 5.0 — 7.0legend no support no support compatibility unknown compatibility unknownnon-standard.

OfflineAudioContext.OfflineAudioContext() - Web APIs
the most commonly-used rate is 44100hz, which is the sample rate used by cd audio.
... example const offlinectx = new offlineaudiocontext({ numberofchannels: 2, length: 44100 * 40, samplerate: 44100, }); const source = offlinectx.createbuffersource(); // etc...

OscillatorNode.frequency - Web APIs
syntax var oscillator = audioctx.createoscillator(); oscillator.frequency.setvalueattime(440, audioctx.currenttime); // value in hertz note: though the audioparam returned is read-only, the value it represents is not.
... // create web audio api context var audioctx = new (window.audiocontext || window.webkitaudiocontext)(); // create oscillator node var oscillator = audioctx.createoscillator(); oscillator.type = 'square'; oscillator.frequency.setvalueattime(440, audioctx.currenttime); // value in hertz oscillator.start(); specifications specification status comment web audio apithe definition of 'frequency' in that specification.

OscillatorNode - Web APIs
the default value is 440 hz (a standard middle-a note).
... // create web audio api context var audioctx = new (window.audiocontext || window.webkitaudiocontext)(); // create oscillator node var oscillator = audioctx.createoscillator(); oscillator.type = 'square'; oscillator.frequency.setvalueattime(440, audioctx.currenttime); // value in hertz oscillator.connect(audioctx.destination); oscillator.start(); specifications specification status comment web audio apithe definition of 'oscillatornode' in that specification.

PushEvent.PushEvent() - Web APIs
full support 17firefox full support 44notes full support 44notes notes extended support releases (esr) before firefox 78 esr do not support service workers and the push api.ie no support noopera full support 37safari no support nowebview android ...
... no support nochrome android full support 42firefox android full support 44 full support 44 full support 48notes notes push enabled by default.opera android full support 37safari ios no support nosamsung internet android full support 4.0legend full support full support no support no supportexperimental.

PushEvent.data - Web APIs
full support 17firefox full support 44notes full support 44notes notes extended support releases (esr) before firefox 78 esr do not support service workers and the push api.ie no support noopera full support 44safari no support nowebview android ...
... no support nochrome android full support 57firefox android full support 44 full support 44 full support 48notes notes push enabled by default.opera android full support 43safari ios no support nosamsung internet android full support 4.0legend full support full support no support no supportexperimental.

PushManager.supportedContentEncodings - Web APIs
full support 17firefox full support 44notes full support 44notes notes extended support releases (esr) before firefox 78 esr do not support service workers and the push api.ie no support noopera full support 47safari no support nowebview android ...
... no support nochrome android full support 60firefox android full support 48notes full support 48notes notes push enabled by default.opera android full support 44safari ios no support nosamsung internet android full support 4.0legend full support full support no support no supportexperimental.

RTCIceCandidate.candidate - Web APIs
for an a-line (attribute line) that looks like this: a=candidate:4234997325 1 udp 2043278322 192.168.0.56 44323 typ host the corresponding candidate string's value will be "candidate:4234997325 1 udp 2043278322 192.168.0.56 44323 typ host".
...the complete list of attributes for this example candidate is: foundation = 4234997325 component = "rtp" (the number 1 is encoded to this string; 2 becomes "rtcp") protocol = "udp" priority = 2043278322 ip = "192.168.0.56" port = 44323 type = "host" example in this example, we see a function which receives as input an sdp string containing an ice candidate received from the remote peer during the signaling process.

RTCIceCandidate.port - Web APIs
usage notes consider this sdp attribute line (a-line) which describes an ice candidate: a=candidate:4234997325 1 udp 2043278322 192.168.0.56 44323 typ host the port number is found in the sixth field, which is "44323".
... in this case, the value of port will be 44323.

RTCIceCandidateInit.candidate - Web APIs
for an a-line (attribute line) that looks like this: a=candidate:4234997325 1 udp 2043278322 192.168.0.56 44323 typ host the corresponding candidate string's value will be "candidate:4234997325 1 udp 2043278322 192.168.0.56 44323 typ host".
...the complete list of attributes for this example candidate is: foundation = 4234997325 component = "rtp" (the number 1 is encoded to this string; 2 becomes "rtcp") protocol = "udp" priority = 2043278322 ip = "192.168.0.56" port = 44323 type = "host" example when a new ice candidate is received by your signaling code from the remote peer, you need to construct the rtcicecandidate object that encapsulates it.

ServiceWorkerRegistration.navigationPreload - Web APIs
full support 59edge full support 17 full support 17 full support 16disabled disabled from version 16: this feature is behind the enable service workers preference.firefox full support 44notes full support 44notes notes extended support releases (esr) before firefox 78 esr do not support service workers and the push api.ie no support noopera full support 46safari full support 11.1webview android ...
... full support 59chrome android full support 59firefox android full support 44opera android full support 43safari ios full support 11.3samsung internet android full support 4.0legend full support full support no support no supportexperimental.

SubtleCrypto.sign() - Web APIs
rsassa-pkcs1-v1_5 the rsassa-pkcs1-v1_5 algorithm is specified in rfc 3447.
... rsa-pss the rsa-pss algorithm is specified in rfc 3447.

URL.origin - Web APIs
the exact structure varies depending on the type of url: for http or https urls, the scheme followed by '://', followed by the domain, followed by ':', followed by the port (the default port, 80 and 443 respectively, if explicitely specified).
... examples const url = new url("blob:https://mozilla.org:443/") console.log(url.origin); // logs 'https://mozilla.org' specifications specification status comment urlthe definition of 'url.origin' in that specification.

URLUtilsReadOnly.origin - Web APIs
the urlutilsreadonly.origin read-only property is a domstring containing the unicode serialization of the origin of the represented url, that is, for http and https, the scheme followed by '://', followed by the domain, followed by ':', followed by the port (the default port, 80 and 443 respectively, if explicitely specified).
... syntax string = object.origin; examples // on this page, returns the origin var result = self.location.origin; // returns:'https://developer.mozilla.org:443' specifications specification status comment urlthe definition of 'urlutilsreadonly.origin' in that specification.

Viewpoints and viewers: Simulating cameras in WebXR - Web APIs
for example, consider a device which uses a 2560x1440 pixel frame buffer.
... dividing this into two parts—half for each eye—results in each eye's view being drawn at a resolution of 1280x1440 pixels.

Advanced techniques: Creating and sequencing audio - Web APIs
the oscillator now we can create an oscillatornode and set its wave to the one we've created: function playsweep() { let osc = audioctx.createoscillator(); osc.setperiodicwave(wave); osc.frequency.value = 440; osc.connect(audioctx.destination); osc.start(); osc.stop(audioctx.currenttime + 1); } controlling amplitude this is great, but wouldn't it be nice if we had an amplitude envelope to go with it?
... let sweeplength = 2; function playsweep() { let osc = audioctx.createoscillator(); osc.setperiodicwave(wave); osc.frequency.value = 440; let sweepenv = audioctx.creategain(); sweepenv.gain.cancelscheduledvalues(audioctx.currenttime); sweepenv.gain.setvalueattime(0, audioctx.currenttime); // set our attack sweepenv.gain.linearramptovalueattime(1, audioctx.currenttime + attacktime); // set our release sweepenv.gain.linearramptovalueattime(0, audioctx.currenttime + sweeplength - releasetime); osc.c...

Background audio processing using AudioWorklet - Web APIs
the second parameter is named frequency and defaults to 440.0, with a range from 275 to 4186.009, inclusively.
... static get parameterdescriptors() { return [ { name: "gain", defaultvalue: 0.5, minvalue: 0, maxvalue: 1 }, { name: "frequency", defaultvalue: 440.0; minvalue: 27.5, maxvalue: 4186.009 } ]; } accessing your processor node's parameters is as simple as looking them up in the parameters object passed into your implementation of process().

Window.sidebar - Web APIs
addsearchengine(engineurl, iconurl, suggestedtitle, suggestedcategory) obsolete since gecko 44 installs a search engine (sherlock).
... note: this was made obsolete in firefox 44, and has been removed completely in firefox 59.

animation-delay - CSS: Cascading Style Sheets
full support 49prefixed prefixed implemented with the vendor prefix: -webkit- full support 44prefixed disabled prefixed implemented with the vendor prefix: -webkit-disabled from version 44: this feature is behind the layout.css.prefixes.webkit preference (needs to be set to true).
... 18prefixed prefixed implemented with the vendor prefix: -webkit-firefox android full support 16 full support 16 full support 49prefixed prefixed implemented with the vendor prefix: -webkit- full support 44prefixed disabled prefixed implemented with the vendor prefix: -webkit-disabled from version 44: this feature is behind the layout.css.prefixes.webkit preference (needs to be set to true).

animation-direction - CSS: Cascading Style Sheets
12prefixed prefixed implemented with the vendor prefix: -webkit-firefox full support 16 full support 16 full support 49prefixed prefixed implemented with the vendor prefix: -webkit- full support 44prefixed disabled prefixed implemented with the vendor prefix: -webkit-disabled from version 44: this feature is behind the layout.css.prefixes.webkit preference (needs to be set to true).
... 18prefixed prefixed implemented with the vendor prefix: -webkit-firefox android full support 16 full support 16 full support 49prefixed prefixed implemented with the vendor prefix: -webkit- full support 44prefixed disabled prefixed implemented with the vendor prefix: -webkit-disabled from version 44: this feature is behind the layout.css.prefixes.webkit preference (needs to be set to true).

position - CSS: Cascading Style Sheets
11samsung internet android full support 6.0fixedchrome full support 1edge full support 12firefox full support 1notes full support 1notes notes before firefox 44, position: fixed didn't create a stacking context in most cases.
... 4safari full support 1webview android full support ≤37chrome android full support 18firefox android full support 4notes full support 4notes notes before firefox 44, position: fixed didn't create a stacking context in most cases.

<input type="tel"> - HTML: Hypertext Markup Language
providing default options as always, you can provide a default value for an tel input box by setting its value attribute: <input id="telno" name="telno" type="tel" value="333-4444-4444"> offering suggested values taking it a step farther, you can provide a list of default phone number values from which the user can select.
... <label for="telno">phone number: </label> <input id="telno" name="telno" type="tel" list="defaulttels"> <datalist id="defaulttels"> <option value="111-1111-1111"> <option value="122-2222-2222"> <option value="333-3333-3333"> <option value="344-4444-4444"> </datalist> with the <datalist> element and its <option>s in place, the browser will offer the specified values as potential values for the email address; this is typically presented as a popup or drop-down menu containing the suggestions.

<tbody>: The Table Body element - HTML: Hypertext Markup Language
<table> <thead> <tr> <th>student id</th> <th>name</th> <th>major</th> </tr> </thead> <tbody> <tr> <td>3741255</td> <td>jones, martha</td> <td>computer science</td> </tr> <tr> <td>3971244</td> <td>nim, victor</td> <td>russian literature</td> </tr> <tr> <td>4100332</td> <td>petrov, alexandra</td> <td>astrophysics</td> </tr> </tbody> </table> css the css to style our table is shown next.
...d> <tbody> <tr> <th colspan="2">computer science</th> </tr> <tr> <td>3741255</td> <td>jones, martha</td> </tr> <tr> <td>4077830</td> <td>pierce, benjamin</td> </tr> <tr> <td>5151701</td> <td>kirk, james</td> </tr> </tbody> <tbody> <tr> <th colspan="2">russian literature</th> </tr> <tr> <td>3971244</td> <td>nim, victor</td> </tr> </tbody> <tbody> <tr> <th colspan="2">astrophysics</th> </tr> <tr> <td>4100332</td> <td>petrov, alexandra</td> </tr> <tr> <td>8892377</td> <td>toyota, hiroko</td> </tr> </tbody> </table> notice that each major is placed in a separate <tbody> block, the first row of which contains a single <th> e...

HTML documentation index - HTML: Hypertext Markup Language
44 html attribute: multiple attribute, attributes, constraint validation the boolean multiple attribute, if set, means the form control accepts one or more values.
... 144 <kbd>: the keyboard input element displaying input, displaying keys, displaying keystrokes, displaying user input, element, html, html text-level semantics, keyboard input, keystroke, reference, web, keyboard, user input the html keyboard input element (<kbd>) represents a span of inline text denoting textual user input from a keyboard, voice input, or any other text entry device.

MIME types (IANA media types) - HTTP
.1 host: localhost:8000 user-agent: mozilla/5.0 (macintosh; intel mac os x 10.9; rv:50.0) gecko/20100101 firefox/50.0 accept: text/html,application/xhtml+xml,application/xml;q=0.9,*/*;q=0.8 accept-language: en-us,en;q=0.5 accept-encoding: gzip, deflate connection: keep-alive upgrade-insecure-requests: 1 content-type: multipart/form-data; boundary=---------------------------8721656041911415653955004498 content-length: 465 -----------------------------8721656041911415653955004498 content-disposition: form-data; name="mytextfield" test -----------------------------8721656041911415653955004498 content-disposition: form-data; name="mycheckbox" on -----------------------------8721656041911415653955004498 content-disposition: form-data; name="myfile"; filename="test.txt" content-type: text/plain...
...-----------------------------8721656041911415653955004498-- multipart/byteranges the multipart/byteranges mime type is used to send partial responses to the browser.

Firefox user agent string reference - HTTP
ring v1.1 mozilla/5.0 (linux; android 5.1.1) applewebkit/537.36 (khtml, like gecko) version/4.0 focus/1.1 chrome/59.0.3017.125 safari/537.36 firefox os form factor gecko user agent string phone mozilla/5.0 (mobile; rv:26.0) gecko/26.0 firefox/26.0 tablet mozilla/5.0 (tablet; rv:26.0) gecko/26.0 firefox/26.0 tv mozilla/5.0 (tv; rv:44.0) gecko/44.0 firefox/44.0 device-specific mozilla/5.0 (mobile; nnnn; rv:26.0) gecko/26.0 firefox/26.0 device-specific user agent strings although it is strongly discouraged by mozilla, some handset manufacturers unfortunately include a token in their device's ua string that represents their device id.
... firefox os version number gecko version number 1.0.1 18.0 1.1 18.1 1.2 26.0 1.3 28.0 1.4 30.0 2.0 32.0 2.1 34.0 2.2 37 2.5 44 it's easy to find the correspondences by looking at the mercurial repository names: repositories starting by mozilla-b2g are the release repositories for firefox os, and have both firefox os and gecko versions in their names.

Proxy servers and tunneling - HTTP
https, port 443).
... note, however, that not all proxy servers support the connect method or limit it to port 443 only.

Array.prototype.every() - JavaScript
function isbigenough(element, index, array) { return element >= 10; } [12, 5, 8, 130, 44].every(isbigenough); // false [12, 54, 18, 130, 44].every(isbigenough); // true using arrow functions arrow functions provide a shorter syntax for the same test.
... [12, 5, 8, 130, 44].every(x => x >= 10); // false [12, 54, 18, 130, 44].every(x => x >= 10); // true​ affecting initial array (modifying, appending, and deleting) the following examples tests the behaviour of the every method when the array is modified.

Date.parse() - JavaScript
date.parse('thu, 01 jan 1970 00:00:00'); returns 14400000 in time zone gmt-0400, and other values in other time zones, since no time zone is provided and the string is not in iso format, therefore the local time zone is used.
... date.parse('thu, 01 jan 1970 00:00:00 gmt-0400'); returns 14400000 no matter the local time zone as a time zone gmt (utc) is provided.

Math.LOG2E - JavaScript
the math.log2e property represents the base 2 logarithm of e, approximately 1.442: math.log2e=log2(e)≈1.442\mathtt{\mi{math.log2e}} = \log_2(e) \approx 1.442 the source for this interactive example is stored in a github repository.
... examples using math.log2e the following function returns the base 2 logarithm of e: function getlog2e() { return math.log2e; } getlog2e(); // 1.4426950408889634 specifications specification ecmascript (ecma-262)the definition of 'math.log2e' in that specification.

TypedArray.prototype.every() - JavaScript
function isbigenough(element, index, array) { return element >= 10; } new uint8array([12, 5, 8, 130, 44]).every(isbigenough); // false new uint8array([12, 54, 18, 130, 44]).every(isbigenough); // true testing typed array elements using arrow functions arrow functions provide a shorter syntax for the same test.
... new uint8array([12, 5, 8, 130, 44]).every(elem => elem >= 10); // false new uint8array([12, 54, 18, 130, 44]).every(elem => elem >= 10); // true specifications specification ecmascript (ecma-262)the definition of 'typedarray.prototype.every' in that specification.

TypedArray.prototype.filter() - JavaScript
function isbigenough(element, index, array) { return element >= 10; } new uint8array([12, 5, 8, 130, 44]).filter(isbigenough); // uint8array [ 12, 130, 44 ] filtering typed array elements using arrow functions arrow functions provide a shorter syntax for the same test.
... new uint8array([12, 5, 8, 130, 44]).filter(elem => elem >= 10); // uint8array [ 12, 130, 44 ] specifications specification ecmascript (ecma-262)the definition of 'typedarray.prototype.filter' in that specification.

WebAssembly.CompileError - JavaScript
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...
... 57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...

WebAssembly.LinkError - JavaScript
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...
... 57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...

WebAssembly.RuntimeError - JavaScript
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...
... 57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...

Web audio codec guide - Web media technologies
g.722 annex b super wide-band: 64 kbps, 80 kbps, and 96 kbps g.722 annex d stereo wide-band: 64 kbps and 80 kbps g.722 annex d stereo super wide-band: 80 kbps, 96 kbps, 112 kbps, and 128 kbps variable bit rate (vbr) support no supported sample formats 14-bit integer supported sample rates 16 khz (adpcm is specified to allow 8 khz, 11.025 khz, 22.05 khz, 44.1 khz, but g.722 uses 16 khz) recommended minimum bit rate for stereo sound 128 kbps at 44.1 khz sample rate compression lossy maximum audio channels 2 audio frequency bandwidth 50 hz - 7 khz latency 4 ms browser compatibility feature chrome edge firefox internet explorer ...
... supported bit rates mpeg-1 mode: 32 kbps, 40 kbps, 48 kbps, 56 kbps, 64 kbps, 80 kbps, 96 kbps, 112 kbps, 128 kbps, 160 kbps, 192 kbps, 224 kbps, 256 kbps, 320 kbps mpeg-2 mode: 8 kbps, 16 kbps, 24 kbps, 32 kbps, 40 kbps, 48 kbps, 56 kbps, 64 kbps, 80 kbps, 96 kbps, 112 kbps, 128 kbps, 144 kbps, 160 kbps variable bit rate (vbr) support yes supported sample formats 16-bit integer supported sample rates mpeg-1 mode: 32000 hz, 44100 hz, 48000 hz mpeg-2 mode: 16000 hz, 22050 hz, 24000 hz (half the frequency of the mpeg-1 supported modes) recommended minimum bit rate for stereo sound 128 kbps at 48 khz sample rate compres...

Media container formats (file types) - Web media technologies
specifications specification comment etsi 3gpp defines the 3gp container format iso/iec 14496-3 (mpeg-4 part 3 audio) defines mp4 audio including adts flac format the flac format specification iso/iec 11172-1 (mpeg-1 part 1 systems) defines the mpeg-1 container format iso/iec 13818-1 (mpeg-2 part 1 systems) defines the mpeg-2 container format iso/iec 14496-14 (mpeg-4 part 14: mp4 file format) defines the mpeg-4 (mp4) version 2 container...
... format iso/iec 14496-1 (mpeg-4 part 1 systems) defines the original mpeg-4 (mp4) container format rfc 3533 defines the ogg container format rfc 5334 defines the ogg media types and file extensions quicktime file format specification defines the quicktime movie (mov) format multimedia programming interface and data specifications 1.0 the closest thing to an official wave specification resource interchange file format (used by wav) defines the riff format; wave files are a form of riff webm container guidelines guide for adapting matroska for webm matroska specifications the specification for the matroska container format upon which webm is based webm byte stream format webm byte stream...

SVG and CSS - SVG: Scalable Vector Graphics
ass="segment-fill" d="m0,0 v-200 a40,40 0 0,0 -62,10 z"/> <path class="segment-edge" d="m0,-200 a40,40 0 0,0 -62,10"/> </g> <g class="segment" transform="rotate(126)"> <path class="segment-fill" d="m0,0 v-200 a40,40 0 0,0 -62,10 z"/> <path class="segment-edge" d="m0,-200 a40,40 0 0,0 -62,10"/> </g> <g class="segment" transform="rotate(144)"> <path class="segment-fill" d="m0,0 v-200 a40,40 0 0,0 -62,10 z"/> <path class="segment-edge" d="m0,-200 a40,40 0 0,0 -62,10"/> </g> <g class="segment" transform="rotate(162)"> <path class="segment-fill" d="m0,0 v-200 a40,40 0 0,0 -62,10 z"/> <path class="segment-edge" d="m0,-200 a40,40 0 0,0 -62,10"/> </g> </g> <g cla...
...ass="segment-fill" d="m0,0 v-200 a40,40 0 0,0 -62,10 z"/> <path class="segment-edge" d="m0,-200 a40,40 0 0,0 -62,10"/> </g> <g class="segment" transform="rotate(126)"> <path class="segment-fill" d="m0,0 v-200 a40,40 0 0,0 -62,10 z"/> <path class="segment-edge" d="m0,-200 a40,40 0 0,0 -62,10"/> </g> <g class="segment" transform="rotate(144)"> <path class="segment-fill" d="m0,0 v-200 a40,40 0 0,0 -62,10 z"/> <path class="segment-edge" d="m0,-200 a40,40 0 0,0 -62,10"/> </g> <g class="segment" transform="rotate(162)"> <path class="segment-fill" d="m0,0 v-200 a40,40 0 0,0 -62,10 z"/> <path class="segment-edge" d="m0,-200 a40,40 0 0,0 -62,10"/> </g> </g> <g cla...

Features restricted to secure contexts - Web security
push api 42 17 not supported 44 reporting api supported not supported not supported behind flag since fx 65 service workers 40 17 11.1 44 storage api 55 not supported not supported 51 web authentication api 65 in preview (17) in development 60 web bluetooth 56 not supported not supported not supported web midi (see ...
... api chrome edge safari firefox application cache restricted to secure contexts planned in chrome 70 deprecation planning started in february 2018 public interest on deprecation webkit bug 182442 restricted to secure contexts in firefox 62 geolocation restricted to secure contexts in 50 restricted to secure contexts in 10 restricted to secure contexts in 55 device orientaion / device motion deprecation warning deprecation warnings since 60.

cfx to jpm - Archive of obsolete content
there is a known bug in simple options handling which may require the workaround described in https://bug635044.bugzilla.mozilla.org/show_bug.cgi?id=1243467 commands and command options permanently removed commands jpm has dropped support for all the "internal" cfx commands.

Tools - Archive of obsolete content
cfx is is no longer supported as of firefox 44 and no longer accepted for add-on submission, jpm should now be used instead.

File I/O - Archive of obsolete content
createinstance(components.interfaces.nsifileinputstream); istream.init(file, 0x01, 0444, 0); istream.queryinterface(components.interfaces.nsilineinputstream); // read lines into array var line = {}, lines = [], hasmore; do { hasmore = istream.readline(line); lines.push(line.value); } while(hasmore); istream.close(); // do something with read data alert(lines); reading a binary file for instance, to get the data in a png file: var ios = components.classes["@mozilla.org/ne...

How to convert an overlay extension to restartless - Archive of obsolete content
,null,null) .queryinterface(components.interfaces.nsifileurl) .file; var stream = components.classes["@mozilla.org/network/file-input-stream;1"] .createinstance(components.interfaces.nsifileinputstream) .queryinterface(components.interfaces.nsiseekablestream); stream.init(file, 0x01, 0444, 0); // read-only, read by owner/group/others, normal behavior /* do stuff */ }); this bit of code is paraphrased and probably not to be recommended as-is, but it should work.

Install Manifests - Archive of obsolete content
examples <em:id>extensionname@example.org</em:id> <em:id>{daf44bf7-a45e-4450-979c-91cf07434c3d}</em:id> name the name of the add-on; intended for display in the ui.

Connecting to Remote Content - Archive of obsolete content
interfaces.nsidomparser); let filestream = components.classes["@mozilla.org/network/file-input-stream;1"] .createinstance(components.interfaces.nsifileinputstream); let xsltprocessor = components.classes["@mozilla.org/document-transformer;1?type=xslt"] .createinstance(components.interfaces.nsixsltprocessor); let xsldocument; filestream.init(somexslfile, -1, 0x01, 0444); // read only // parse from the xslt stylesheet file stream xsldocument = domparser.parsefromstream( filestream, null, filestream.available(), "text/xml"); // import the xslt stylesheet to the xslt processor xsltprocessor.importstylesheet(xsldocument); finally, you can either use nsixsltprocessor.transformtodocument() or nsixsltprocessor.transformtofragment() methods to transform the xm...

Creating a dynamic status bar extension - Archive of obsolete content
the text we receive back from the server looks something like this: "goog",414.20,"5/1/2006","1:36pm",-3.74,417.85,419.44,412.19,4760215 we then parse the text.

MMgc - Archive of obsolete content
output looks like this: [mem] ------- gross stats ----- [mem] private 5877 (23.0m) 100% [mem] mmgc 5792 (22.6m) 98% [mem] unmanaged 13 (52k) 0% [mem] managed 2596 (10.1m) 44% [mem] free 3081 (12.0m) 52% [mem] jit 0 (0k) 0% [mem] other 85 (340k) 1% [mem] bytes (interal fragmentation) 2527 (9.9m) 96% [mem] managed bytes 2520 (9.8m) 97% [mem] unmanaged bytes 7 (28k) 53% [mem] -------- gross stats end ----- numbers are in pages (with m and k in parens).

Monitoring WiFi access points - Archive of obsolete content
starting to monitor access points to start monitoring the access points, we instantiate the listener (on line 44), then get access to the wifi monitor interface on line 45.

No Proxy For configuration - Archive of obsolete content
proxy: "no proxy for" items bug 80917 - proxy: "no proxy" w/ form based ui bug 91587 - proxy: "no proxy for" default domain filtering fails w/ non-fqdn (e.g., http://web/) bug 201685 - no proxy for: support ipv6 address literals bug 136789 - proxy: no proxy ip entries do not block dns resolved ips bug 314712 - no proxy for: "hostname.domain.com" should block only "hostname.domain.com" bug 72444 - proxy: "bypass proxy server for local addresses" (ie pref) bug 260883 - "no proxy for" does not use fqdn wildcards "*" like ie bugzilla sources bug 17158 comment 21: the correct separator are spaces or commas.

Creating a Microsummary - Archive of obsolete content
in this tutorial we're going to create a microsummary generator for the spread firefox home page that displays the current firefox download count along with the label fx downloads; for example: 174475447 fx downloads.

Clipboard Test - Archive of obsolete content
<style></style> <style>.description{ display: block; font-size: 13pt; color: #444; font-style: italic; margin-bottom: 7px; } .method>.returns{display: none;} .method>.name>.param:not(:last-child):after{content: ","; padding-right: .5em; } .method>.name>.param:not(:last-child):after{content: ","; padding-right: .5em; } .method>.name>.param>.name:after{content: " as "; font-weight: normal; } .method>.params{display: block; color:#555;} .method>.params>.param{display: block; margin-bottom:5px;} .method>.params>.param>.name{font-weight:bold; margin-right:.5em; min-width:80px; display:inline-block;} .method>.params>.param>.description{display:inline-block; width:300px; vertical-align:top;margin-right:30px} .method>.params>.param>.type{display:inline-block; width:100px; vertical-align:top;font-wei...

jspage - Archive of obsolete content
is.instance]={};var e=m.params,g=m.vars,f=m.callbacks;var h=$extend({height:m.height,width:m.width},m.properties);var k=this;for(var d in f){swiff.callbacks[this.instance][d]=(function(n){return function(){return n.apply(k.object,arguments); };})(f[d]);g[d]="swiff.callbacks."+this.instance+"."+d;}e.flashvars=hash.toquerystring(g);if(browser.engine.trident){h.classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000"; e.movie=l;}else{h.type="application/x-shockwave-flash";h.data=l;}var j='<object id="'+b+'"';for(var i in h){j+=" "+i+'="'+h[i]+'"';}j+=">";for(var c in e){if(e[c]){j+='<param name="'+c+'" value="'+e[c]+'" />'; }}j+="</object>";this.object=((a)?a.empty():new element("div")).set("html",j).firstchild;},replaces:function(a){a=document.id(a,true);a.parentnode.replacechild(this.toelement(),...

Modularization techniques - Archive of obsolete content
#include "nsifactory.h" // {d3944dd0-ae1a-11d1-b66c-00805f8a2676} #define ns_sample_cid \ {0xd3944dd0, 0xae1a, 0x11d1, \ {0xb6, 0x6c, 0x00, 0x80, 0x5f, 0x8a, 0x26, 0x76}} extern nsresult getsamplefactory(nsifactory **aresult); file nssample.cpp nssample.cpp contains both the declaration and implementation of our sample class, and the declaration and implementation of our class factory.

LIR - Archive of obsolete content
36 calld double call subroutine that returns a double branch 37 j void jump always 38 jt void jump if true 39 jf void jump if false 40 jtbl void jump to address in table 41 label void a jump target (no machine code is emitted for this) 42 not in use guards 43 x void exit always 44 xt void exit if true 45 xf void exit if false 46 xtbl void exit via indirect jump 47 xbarrier void a lir_xbarrier cause no code to be generated, but it acts like a never-taken guard in that it inhibits certain optimisations, such as dead stack store elimination.

Tamarin build documentation - Archive of obsolete content
this sdk/ndk *must* be used if you've cloned tamarin at changeset 5844:92ad3ca84a0b or later and will be using the cross-compile build method.

Tamarin Roadmap - Archive of obsolete content
tc jan '09 feature links status integrate the tt string class tamarin:string implementation tamarin:strings bug 465506 complete enhanced c++ profiler enhance memory profiler to work in release builds and be more performant in progress enable lir for arm targets bug 460764 complete amd64 nanojit bug 464476 in progress port nanojit to powerpc bug 458077 complete add mac-x64 and linux-x64 buildbots complete fail build on assertion in acceptance tests complete merge tracking bug bug 469836 in progress tc feb '09 spring backlog tbd.

URIScheme - Archive of obsolete content
list of mozilla supported uri schemes list of uri schemes http:// by default, port 80 https:// by default, port 443 (ssl) ftp:// by default, port 21 file:// : file:///etc/hosts on unix/linux, file:///c:/some/file.txt on windows.

Using gdb on wimpy computers - Archive of obsolete content
you can see what libraries you already have loaded with the info sharedlibrary command: (gdb) info shar from to syms read shared object library 0x4044a000 0x4044d08c yes /lib/libdl.so.2 0x4044e000 0x4048ff90 yes /usr/lib/libstdc++-libc6.1-1.so.2 0x40491000 0x404ad9d8 yes /lib/libm.so.6 0x404ae000 0x405a285c yes /lib/libc.so.6 0x40000000 0x40013ed0 yes /lib/ld-linux.so.2 0x40607000 0x4061554c no /usr/lib/libz.so.1 0x40763000 0x4088af74 no /usr/lib/libgtk-1.2.so.0 0x4088b000 ...

Windows Install - Archive of obsolete content
= getfolder(fprogram, listlongfilepaths[i]); sshortfilepath = file.windowsgetshortname(flongfilepath); if(sshortfilepath) { fren8dot3ini.writestring("rename", sshortfilepath, flongfilepath); binicreated = true; } } if(binicreated) updatewinreg4ren8dot3() ; } return(0); } // main var srdest; var err; var fprogram; srdest = 449; err = initinstall(prettyname, regname, "6.0.0.2000110801"); logcomment("initinstall: " + err); fprogram = getfolder("program"); logcomment("fprogram: " + fprogram); if(verifydiskspace(fprogram, srdest)) { setpackagefolder(fprogram); err = adddirectory("", "6.0.0.2000110801", "bin", // dir name in jar to extract fprogram, // where to put this file // (returned f...

Installer Script - Archive of obsolete content
registerchrome(content | delayed_chrome, getfolder(cf,"toolkit.xpi"),"content/global/"); 44.

Getting File Information - Archive of obsolete content
the default permissions for files when created through an output stream is 0644, which means that the file is readable and writable by the owner of the file and read only for others.

How to implement a custom XUL query processor component - Archive of obsolete content
"black"}, {name: "joe", age: 15, hair: "blond", eye: "blue"}, {name: "jimmy", age: 65, hair: "gray", eye: "dull"} ]; } templatequeryprocessor.prototype = { queryinterface: xpcomutils.generateqi([components.interfaces.nsixultemplatequeryprocessor]), classdescription: "sample xul template query processor", classid: components.id("{282cc4ea-a49c-44fc-81f4-1f03cbb7825f}"), contractid: "@mozilla.org/xul/xul-query-processor;1?name=simpledata", getdatasource: function(adatasources, arootnode, aistrusted, abuilder, ashoulddelaybuilding) { // todo: parse the adatasources variable // for now, ignore everything and let's just signal that we have data return this._data; }, initializeforbuilding: function(adatasource, abuilder, ...

The Joy of XUL - Archive of obsolete content
libical is an open source implementation of the ietf's icalendar calendaring and scheduling protocols (rfc 2445, rfc 2446, and rfc 2447).

Deploying XULRunner - Archive of obsolete content
xulrunner 39 and later due to mac os x code signing rules and how they interact with the design of xulrunner (see bug 1105044 for the inside scoop), starting with xulrunner 39 the xulrunner library files are no longer able to reside in a xulrunner framework directory.

XULRunner tips - Archive of obsolete content
\myapp\extensions{972ce4c6-7e08-4474-a285-3208198ce6fd}\install.rdf it should also have an <em:internalname>classic/1.0</em:internalname> as that is the default theme in firefox.

2006-11-10 - Archive of obsolete content
this is already addressed in bug 244030.

2006-11-03 - Archive of obsolete content
he has also created a bug entry on bugzilla with the bug id of opened bug #344854.

Adobe Flash - Archive of obsolete content
the following code snippet illustrates the ideas behind the use of fscommands demonstrated in example 3: <object classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" codebase="http://download.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#version=6,0,0,0" id="myflash" width="250" height="150" viewastext> <param name="movie" value="js2flash.swf" /> <param name="quality" value="high"></param> <embed src="js2flash.swf" width="250" height="150" swliveconnect="true" quality="high" pluginspage="http://www.macromedia.com/go/getflashplayer" ...

The First Install Problem - Archive of obsolete content
the bugzilla bug open on mozilla and netscape 6.x is bug 44973.

Introduction to Public-Key Cryptography - Archive of obsolete content
33:5a:31:7a:e6:5c:fb:36: 26:c9 signature: algorithm: pkcs #1 md5 with rsa encryption signature: 6d:23:af:f3:d3:b6:7a:df:90:df:cd:7e:18:6c:01:69:8e:54:65:fc:06: 30:43:34:d1:63:1f:06:7d:c3:40:a8:2a:82:c1:a4:83:2a:fb:2e:8f:fb: f0:6d:ff:75:a3:78:f7:52:47:46:62:97:1d:d9:c6:11:0a:02:a2:e0:cc: 2a:75:6c:8b:b6:9b:87:00:7d:7c:84:76:79:ba:f8:b4:d2:62:58:c3:c5: b6:c1:43:ac:63:44:42:fd:af:c8:0f:2f:38:85:6d:d6:59:e8:41:42:a5: 4a:e5:26:38:ff:32:78:a1:38:f1:ed:dc:0d:31:d1:b0:6d:67:e9:46:a8: d:c4 here is the same certificate displayed in the 64-byte-encoded form interpreted by software: -----begin certificate----- miickzccazsgawibagibazanbgkqhkig9w0baqqfada3mqswcqydvqqgewjvuzer ma8ga1uechmitmv0c2nhcguxftatbgnvbastdfn1chjpewencybdqtaefw05nzew mtgwmtm2mjvafw05ot...

SSL and TLS - Archive of obsolete content
for more information on ecc, see rfc 4492, section 5.6.1, table 2.

-moz-window-shadow - Archive of obsolete content
this property is not standard and from firefox 44 onwards cannot be used on websites anymore.

Array comprehensions - Archive of obsolete content
here is one that filters just the even numbers, then creates an array containing their doubles: var numbers = [1, 2, 3, 21, 22, 30]; var doubledevens = [for (i of numbers) if (i % 2 === 0) i * 2]; console.log(doubledevens); // logs 4,44,60 the square brackets of an array comprehension introduce an implicit block for scoping purposes.

LiveConnect - Archive of obsolete content
mailing list newsgroup rss feed related topics javascript, plugins older notes (please update or remove as needed.) while the bloated liveconnect code in the mozilla source was removed in version 1.9.2 of the platform (see bug 442399), its former api has been restored (see also the specification and this thread) (building on npapi?), and as of java 6 update 12, extensions as well as applets can make use of this restored api.

Anatomy of a video game - Game development
different monitors input at different rates: 30 fps, 75 fps, 100 fps, 120 fps, 144 fps, etc.

Index - Game development
44 bounce off the walls 2d, beginner, canvas, games, javascript, phaser, tutorial, bouncing now that physics have been introduced, we can start implementing collision detection into the game — first we'll look at the walls.

Port - MDN Web Docs Glossary: Definitions of Web-related terms
for example, the default port for the http protocol is 80 and the default port for the https protocol is 443, so a http server waits for requests on those ports.

Quality values - MDN Web Docs Glossary: Definitions of Web-related terms
they used to be clamped to only 1 decimal place in earlier versions (bug 672448).

Response header - MDN Web Docs Glossary: Definitions of Web-related terms
ders are entity header: 200 ok access-control-allow-origin: * connection: keep-alive content-encoding: gzip content-type: text/html; charset=utf-8 date: mon, 18 jul 2016 16:06:00 gmt etag: "c561c68d0ba92bbeb8b0f612a9199f722e3a621a" keep-alive: timeout=5, max=997 last-modified: mon, 18 jul 2016 02:36:04 gmt server: apache set-cookie: mykey=myvalue; expires=mon, 17-jul-2017 16:06:00 gmt; max-age=31449600; path=/; secure transfer-encoding: chunked vary: cookie, accept-encoding x-backend-server: developer2.webapp.scl3.mozilla.com x-cache-info: not cacheable; meta data too large x-kuma-revision: 1085259 x-frame-options: deny ...

SDP - MDN Web Docs Glossary: Definitions of Web-related terms
here is a typical sdp message: v=0 o=alice 2890844526 2890844526 in ip4 host.anywhere.com s= c=in ip4 host.anywhere.com t=0 0 m=audio 49170 rtp/avp 0 a=rtpmap:0 pcmu/8000 m=video 51372 rtp/avp 31 a=rtpmap:31 h261/90000 m=video 53000 rtp/avp 32 a=rtpmap:32 mpv/90000 sdp is never used alone, but by protocols like rtp and rtsp.

WebDAV - MDN Web Docs Glossary: Definitions of Web-related terms
author or creation date) link pages of any media type to related pages create sets of documents and retrieve hierarchical list copy and move webpages lock a document from being edited by more than one person at a time learn more general knowledge webdav on wikipedia technical reference rfc 2518 rfc 3253 rfc 3744 ...

How do you make sure your website works properly? - Learn web development
ping is a useful shell tool that tests the domain name you provide and tells you if the server's responding or not: $ ping mozilla.org ping mozilla.org (63.245.215.20): 56 data bytes 64 bytes from 63.245.215.20: icmp_seq=0 ttl=44 time=148.741 ms 64 bytes from 63.245.215.20: icmp_seq=1 ttl=44 time=148.541 ms 64 bytes from 63.245.215.20: icmp_seq=2 ttl=44 time=148.734 ms 64 bytes from 63.245.215.20: icmp_seq=3 ttl=44 time=147.857 ms ^c --- mozilla.org ping statistics --- 4 packets transmitted, 4 packets received, 0.0% packet loss round-trip min/avg/max/stddev = 147.857/148.468/148.741/0.362 ms just keep in mind a handy key...

What is a URL? - Learn web development
it is usually omitted if the web server uses the standard ports of the http protocol (80 for http and 443 for https) to grant access to its resources.

What’s in the head? Metadata in HTML - Learn web development
for example, you'll find this in the source code of the mdn web docs homepage: <!-- third-generation ipad with high-resolution retina display: --> <link rel="apple-touch-icon-precomposed" sizes="144x144" href="https://developer.cdn.mozilla.net/static/img/favicon144.a6e4162070f4.png"> <!-- iphone with high-resolution retina display: --> <link rel="apple-touch-icon-precomposed" sizes="114x114" href="https://developer.cdn.mozilla.net/static/img/favicon114.0e9fabd44f85.png"> <!-- first- and second-generation ipad: --> <link rel="apple-touch-icon-precomposed" sizes="72x72" href="https://developer...

HTML table basics - Learn web development
2 the red planet jovian planets gas giants jupiter 1898 142,984 1326 23.1 9.9 778.6 -110 67 the largest planet saturn 568 120,536 687 9.0 10.7 1433.5 -140 62 ice giants uranus 86.8 51,118 1271 8.7 17.2 2872.5 -195 27 neptune 102 49,528 1638 11.0 16.1 4495.1 -200 14 dwarf planets pluto 0.0146 2,370 2095 0.7 153.3 5906.4 -225 5 declassified as a planet in 2006, but this remains controversial.

What went wrong? Troubleshooting JavaScript - Learn web development
the instance that stores the random number that we want to guess at the start of the game should be around line number 44: let randomnumber = math.floor(math.random()) + 1; and the one that generates the random number before each subsequent game is around line 113: randomnumber = math.floor(math.random()) + 1; to check whether these lines are indeed the problem, let's turn to our friend console.log() again — insert the following line directly below each of the above two lines: console.log(randomnumbe...

Beginning our React todo list - Learn web development
o-text { width: 100%; min-height: 4.4rem; padding: 0.4rem 0.8rem; border: 2px solid #565656; } .todo-text:focus { box-shadow: inset 0 0 0 2px; } /* checkbox styles */ .c-cb { box-sizing: border-box; font-family: arial, sans-serif; -webkit-font-smoothing: antialiased; font-weight: 400; font-size: 1.6rem; line-height: 1.25; display: block; position: relative; min-height: 44px; padding-left: 40px; clear: left; } .c-cb > label::before, .c-cb > input[type="checkbox"] { box-sizing: border-box; top: -2px; left: -2px; width: 44px; height: 44px; } .c-cb > input[type="checkbox"] { -webkit-font-smoothing: antialiased; cursor: pointer; position: absolute; z-index: 1; margin: 0; opacity: 0; } .c-cb > label { font-size: inherit; font-family: inheri...

Starting our Svelte Todo list app - Learn web development
o-text { width: 100%; min-height: 4.4rem; padding: 0.4rem 0.8rem; border: 2px solid #565656; } .todo-text:focus { box-shadow: inset 0 0 0 2px; } /* checkbox styles */ .c-cb { box-sizing: border-box; font-family: arial, sans-serif; -webkit-font-smoothing: antialiased; font-weight: 400; font-size: 1.6rem; line-height: 1.25; display: block; position: relative; min-height: 44px; padding-left: 40px; clear: left; } .c-cb > label::before, .c-cb > input[type="checkbox"] { box-sizing: border-box; top: -2px; left: -2px; width: 44px; height: 44px; } .c-cb > input[type="checkbox"] { -webkit-font-smoothing: antialiased; cursor: pointer; position: absolute; z-index: 1; margin: 0; opacity: 0; } .c-cb > label { font-size: inherit; font-family: inheri...

Getting started with Svelte - Learn web development
for example, here's the link for a repl running our complete app: https://svelte.dev/repl/378dd79e0dfe4486a8f10823f3813190?version=3.23.2.

Advanced Svelte: Reactivity, lifecycle, accessibility - Learn web development
repl to see the current state of the code in a repl, visit: https://svelte.dev/repl/d1fa84a5a4494366b179c87395940039?version=3.23.2 summary in this article we have finished adding all the required functionality to our app, plus we've taken care of a number of accessibility and usability issues.

Styling Vue components with CSS - Learn web development
f; -webkit-font-smoothing: antialiased; font-weight: 400; font-size: 1.6rem; line-height: 1.25; display: block; position: relative; min-height: 40px; margin-bottom: 10px; padding-left: 40px; clear: left; } .custom-checkbox > input[type="checkbox"] { -webkit-font-smoothing: antialiased; cursor: pointer; position: absolute; z-index: 1; top: -2px; left: -2px; width: 44px; height: 44px; margin: 0; opacity: 0; } .custom-checkbox > .checkbox-label { font-size: inherit; font-family: inherit; line-height: inherit; display: inline-block; margin-bottom: 0; padding: 8px 15px 5px; cursor: pointer; touch-action: manipulation; } .custom-checkbox > label::before { content: ""; box-sizing: border-box; position: absolute; top: 0; left: 0; wi...

Understanding client-side JavaScript frameworks - Learn web development
for a running live version, see our svelte repl at https://svelte.dev/repl/378dd79e0dfe4486a8f10823f3813190?version=3.23.2.

Lightweight themes
ultrawide monitors can run to 3440px wide, to look good on these monitors, ensure the left of the image fades to a solid color.

Cookies Preferences in Mozilla
= only accept from the originating site (block third party cookies) 2 = block all cookies by default 3 = use p3p settings (note: this is only applicable to older mozilla suite and seamonkey versions.) 4 = storage access policy: block cookies from trackers network.cookie.lifetimepolicy default value: 0 0 = accept cookies normally 1 = prompt for each cookie (prompting was removed in firefox 44) 2 = accept for current session only 3 = accept for n days network.cookie.lifetime.days default value: 90 only used if network.cookie.lifetimepolicy is set to 3 sets the number of days that the lifetime of cookies should be limited to.

Simple Thunderbird build
18/10/2010 16:11 7,334 mapiaux.h 02/06/2009 17:02 7,938 mapicode.h 02/06/2009 17:02 22,960 mapidbg.h 02/06/2009 17:02 84,644 mapidefs.h 02/06/2009 17:02 27,840 mapiform.h 02/06/2009 17:02 11,880 mapiguid.h 02/06/2009 17:02 2,648 mapihook.h 02/06/2009 17:02 5,359 mapinls.h 02/06/2009 17:02 2,743 mapioid.h 02/06/2009 17:02 32,978 mapispi.h 02/06/2009 17:02 54,395 mapitags.h 02/06/2009 17:02 26,467 mapiutil.h 02/06/2009 17:...

Error codes returned by Mozilla APIs
_failed (0x804b0034) ns_error_cache_key_not_found (0x804b003d) ns_error_cache_data_is_stream (0x804b003e) ns_error_cache_data_is_not_stream (0x804b003f) ns_error_cache_wait_for_validation (0x804b0040) ns_error_cache_entry_doomed (0x804b0041) ns_error_cache_read_access_denied (0x804b0042) ns_error_cache_write_access_denied (0x804b0043) ns_error_cache_in_use (0x804b0044) ns_error_document_not_cached (0x804b0046) ns_error_net_interrupt (0x804b0047) ns_error_proxy_connection_refused (0x804b0048) ns_error_already_opened (0x804b0049) returned from nsichannel.asyncopen() when trying to open the channel again (reopening is not supported).

-moz-window-dragging
the property was added in firefox 35 to solve intermittent problems related to firefox windows not being moveable when busy (bug 944836).

FileUtils.jsm
to the pr_rdonly parameter to pr_open mode_wronly 0x02 corresponds to the pr_wronly parameter to pr_open mode_create 0x08 corresponds to the pr_create_file parameter to pr_open mode_append 0x10 corresponds to the pr_append parameter to pr_open mode_truncate 0x20 corresponds to the pr_truncate parameter to pr_open perms_file 0644 default permissions when creating files.

Localization technical reviews
for more info about utf-7 in firefox, see bug 441876.

Extras
<mrow> <mo>(</mo> <mtable> <mtr> <mtd><mi>cos</mi><mi>θ</mi></mtd> <mtd><mo>−</mo><mi>sin</mi><mi>θ</mi></mtd> </mtr> <mtr> <mtd><mi>sin</mi><mi>θ</mi></mtd> <mtd><mi>cos</mi><mi>θ</mi></mtd> </mtr> </mtable> <mo>)</mo> </mrow> </math> </foreignobject> <text>rotation matrix</text> </switch> </g></g></g> <g> <animatemotion path="m 32,69 c 64,121 100,27 152,42 203,56 239,257 275,161 295,109 144,221 88,214 -2,202 11,35 32,69 z" begin="0s" dur="20s" repeatcount="indefinite"/> <animatetransform attributename="transform" attributetype="xml" type="scale" values="1;2;.5;1" keytimes="0;.25;.75;1" dur="20s" repeatcount="indefinite"/> <circle fill="url(#grad3)" r="30"/> <g transform="translate(-30,-30)"> <switch> <foreignobject...

Mozilla MathML Status
see bug 544001.

Investigating leaks using DMD heap scan mode
144 bytes is the size of that block.

Leak Gauge
results of processing log leak.log : summary: leaked 0 out of 11 dom windows leaked 0 out of 44 documents leaked 0 out of 3 docshells leaked content nodes in 0 out of 0 documents if there are leaks, output will look like the following.

about:memory
��─1,353,696 b (00.14%) ++ top(chrome://chatzilla/content/output-window.html, id=4298) │ │ └─────45,328 b (00.00%) ++ js-non-window/zones/zone(0x100496800)/compartment([system principal], file:///users/njn/library/application%20support/firefox/profiles/puna0zr8.new/extensions/%7b59c81df5-4b7a-477b-912d-4e0fdf64e5f2%7d/components/chatzilla-service.js) │ └───1,872,144 b (00.19%) ++ treestyletab@piro.sakura.ne.jp/js-non-window/zones/zone(0x100496800) more things worth pointing out are as follows.

tools/power/rapl
total w = _pkg_ (cores + _gpu_ + other) + _ram_ w #01 5.17 w = 1.78 ( 0.12 + 0.10 + 1.56) + 3.39 w #02 9.43 w = 5.44 ( 1.44 + 1.20 + 2.80) + 3.98 w #03 14.26 w = 10.21 ( 5.47 + 0.19 + 4.55) + 4.04 w #04 10.02 w = 6.15 ( 2.62 + 0.43 + 3.10) + 3.86 w #05 14.63 w = 10.43 ( 4.41 + 0.81 + 5.22) + 4.19 w #06 11.16 w = 6.90 ( 1.91 + 1.68 + 3.31) + 4.26 w #07 5.40 w = 1.97 ( 0.20 + 0.10 + 1.67) + 3.44 w #08 5.17 w = 1.76 ( 0.07 + 0.08 + 1.60) + 3.41 w #09 5.17 w = 1.76 ( 0.09 + 0.08 + 1.5...

turbostat
sudo modprobe msr the output is as follows: core cpu avg_mhz %busy bzy_mhz tsc_mhz smi cpu%c1 cpu%c3 cpu%c6 cpu%c7 coretmp pkgtmp pkg%pc2 pkg%pc3 pkg%pc6 pkg%pc7 pkgwatt corwatt gfxwatt - - 799 21.63 3694 3398 0 12.02 3.16 1.71 61.48 49 49 0.00 0.00 0.00 0.00 22.68 15.13 1.13 0 0 821 22.44 3657 3398 0 9.92 2.43 2.25 62.96 39 49 0.00 0.00 0.00 0.00 22.68 15.13 1.13 0 4 708 19.14 3698 3398 0 13.22 1 1 743 20.26 3666 3398 0 21.40 4.01 1.42 52.90 49 1 5 1206 31.98 3770 3398 0 9.69 2 2 784 21.29 3681 ...

Performance
the "leaks" tool is not recommended for use with spidermonkey or firefox, because it gets confused by tagged pointers and thinks objects have leaked when they have not (see bug 390944).

Running NSPR tests
nsprpub/pr/tests/runtests.sh in the directory where the test program binaries reside, for example, cvs -q co -r nspr_4_6_6_rtm mozilla/nsprpub mkdir linux.debug cd linux.debug ../mozilla/nsprpub/configure gmake cd pr/tests gmake ../../../mozilla/nsprpub/pr/tests/runtests.sh the output of the test suite looks like this: nspr test results - tests begin mon mar 12 11:44:41 pdt 2007 nspr_test_logfile /dev/null test result accept passed acceptread passed acceptreademu passed affinity passed alarm passed anonfm passed atomic passed attach passed bigfile passed clean...

NSS_3.12.2_release_notes.html
bug 444974: crash upon reinsertion of e-identity smartcard bug 447563: modutil -add prints no error explanation on failure bug 448431: pk11_createmergelog() declaration causes gcc warning when compiling with -wstrict-prototypes bug 449334: pk12util has duplicate options letters bug 449725: signver is still using static libraries.

NSS 3.12.5 release_notes
0436: add macros for build numbers (4th component of version number) to nssutil.h bug 511227: firefox 3.0.13 fails to compile on freebsd/powerpc bug 511312: nss fails to load softoken, looking for sqlite3.dll bug 511781: add new tls 1.2 cipher suites implemented in windows 7 to ssltap bug 516101: if pk11_importcert fails, it leaves the certificate undiscoverable by cert_pkixverifycert bug 518443: pk11_importandreturnprivatekey leaks an arena bug 518446: pk11_derencodepublickey leaks a certsubjectpublickeyinfo bug 518457: seckey_encodedersubjectpublickeyinfo and pk11_derencodepublickey are duplicate bug 522510: add deprecated comments to key.h and pk11func.h bug 522580: nss uses port_memcmp for comparing secret data.

NSS 3.12.9 release notes
bug 536485: crash during ssl handshake in [@ intel_aes_decrypt_cbc_256] bug 444367: nss 3.12 softoken returns the certificate type of a certificate object as ckc_x_509_attr_cert.

NSS 3.14.2 release notes
(https://bugzilla.mozilla.org/show_bug.cgi?id=816853) bug 772144 - basic support for running nss test suites on android devices.this is currently limited to running tests from a linux host machine using an ssh connection.

NSS 3.14 release notes
bug 783448 - when performing an ssl renegotiation, the client_version that is sent in the renegotiation clienthello will be set to match the client_version that was sent in the initial clienthello.

NSS 3.16.3 release notes
notable changes in nss 3.16.3 the following 1024-bit ca certificates were removed cn = entrust.net secure server certification authority sha1 fingerprint: 99:a6:9b:e6:1a:fe:88:6b:4d:2b:82:00:7c:b8:54:fc:31:7e:15:39 cn = gte cybertrust global root sha1 fingerprint: 97:81:79:50:d8:1c:96:70:cc:34:d8:09:cf:79:44:31:36:7e:f4:74 ou = valicert class 1 policy validation authority sha1 fingerprint: e5:df:74:3c:b6:01:c4:9b:98:43:dc:ab:8c:e8:6a:81:10:9f:e4:8e ou = valicert class 2 policy validation authority sha1 fingerprint: 31:7a:2a:d0:7f:2b:33:5e:f5:a1:c3:4e:4b:57:e8:b7:d8:f1:fc:a6 ou = valicert class 3 policy validation authority sha1 fingerp...

NSS 3.16.4 release notes
cn = gte cybertrust global root sha1 fingerprint: 97:81:79:50:d8:1c:96:70:cc:34:d8:09:cf:79:44:31:36:7e:f4:74 in nss 3.16.3, the 1024-bit "entrust.net secure server certification authority" root ca certificate (sha1 fingerprint: 99:a6:9b:e6:1a:fe:88:6b:4d:2b:82:00:7c:b8:54:fc:31:7e:15:39) was removed.

NSS 3.17.4 release notes
bug 1094492: fixed a memory corruption issue during failure of keypair generation.

NSS 3.19.3 release notes
notable changes in nss 3.19.3 the following ca certificates were removed cn = buypass class 3 ca 1 sha1 fingerprint: 61:57:3a:11:df:0e:d8:7e:d5:92:65:22:ea:d0:56:d7:44:b3:23:71 cn = tÜrktrust elektronik sertifika hizmet sağlayıcısı sha1 fingerprint: 79:98:a3:08:e1:4d:65:85:e6:c2:1e:15:3a:71:9f:ba:5a:d3:4a:d9 cn = sg trust services racine sha1 fingerprint: 0c:62:8f:5c:55:70:b1:c9:57:fa:fd:38:3f:b0:3d:7b:7d:d7:b9:c6 cn = tc trustcenter universal ca i sha-1 fingerprint: 6b:2f:34:ad:89:58:be:62:...

NSS 3.20 release notes
nss embeds fixed dhe parameters sized 2048, 3072, 4096, 6144 and 8192 bits, which were copied from version 08 of the internet-draft "negotiated finite field diffie-hellman ephemeral parameters for tls", appendix a.

NSS 3.21.4 release notes
bugs fixed in nss 3.21.4 bug 1344380 / out-of-bounds write in base64 encoding in nss (cve-2017-5461) bug 1345089 / drbg flaw in nss (cve-2017-5462) acknowledgements the nss development team would like to thank ronald crane and vladimir klebanov for responsibly disclosing the issues by providing advance copies of their research.

NSS 3.23 release notes
:b6:b3:99:6f:c2:f3:06:b3:fd:86:81:bd:63:41:3d:8c:50:09:cc:4f:a3:29:c2:cc:f0:e2:fa:1b:14:03:05 friendly name: verisign class 3 public pca – g2 sha-256 fingerprint: 83:ce:3c:12:29:68:8a:59:3d:48:5f:81:97:3c:0f:91:95:43:1e:da:37:cc:5e:36:43:0e:79:c7:a8:88:63:8b cn = ca disig sha-256 fingerprint: 92:bf:51:19:ab:ec:ca:d0:b1:33:2d:c4:e1:d0:5f:ba:75:b5:67:90:44:ee:0c:a2:6e:93:1f:74:4f:2f:33:cf the following ca certificates were added cn = szafir root ca2 sha-256 fingerprint: a1:33:9d:33:28:1a:0b:56:e5:57:d3:d3:2b:1c:e7:f9:36:7e:b0:94:bd:5f:a7:2a:7e:50:04:c8:de:d7:ca:fe cn = certum trusted network ca 2 sha-256 fingerprint: b6:76:f2:ed:da:e8:77:5c:d3:6c:b0:f6:3c:d1:d4:60:39:61:f4:9e:62:65:ba:01:3a:2f:03...

NSS 3.25 release notes
ca:56:fd:c6:27:4a:89:26:a7:83:5f:32:31:3d the following ca certificates were added cn = hellenic academic and research institutions rootca 2015 sha-256 fingerprint: a0:40:92:9a:02:ce:53:b4:ac:f4:f2:ff:c6:98:1c:e4:49:6f:75:5e:6d:45:fe:0b:2a:69:2b:cd:52:52:3f:36 cn = hellenic academic and research institutions ecc rootca 2015 sha-256 fingerprint: 44:b5:45:aa:8a:25:e6:5a:73:ca:15:dc:27:fc:36:d2:4c:1c:b9:95:3a:06:65:39:b1:15:82:dc:48:7b:48:33 cn = certplus root ca g1 sha-256 fingerprint: 15:2a:40:2b:fc:df:2c:d5:48:05:4d:22:75:b3:9c:7f:ca:3e:c0:97:80:78:b0:f0:ea:76:e5:61:a6:c7:43:3e cn = certplus root ca g2 sha-256 fingerprint: 6c:c0:50:41:e6:44:5e:74:69:6c:4c:fb:c9:f8:0f:54:3b:7e:ab:bb:44:b4:ce:6f:78...

NSS 3.27 release notes
:be:e0:91:aa:95:2f:41:34:8f:f8:8b:aa:86:3b:22:64:be:fa:c8:07:90:15:74:e9:39 cn = ebg elektronik sertifika hizmet sağlayıcısı sha-256 fingerprint: 35:ae:5b:dd:d8:f7:ae:63:5c:ff:ba:56:82:a8:f0:0b:95:f4:84:62:c7:10:8e:e9:a0:e5:29:2b:07:4a:af:b2 cn = s-trust authentication and encryption root ca 2005:pn sha-256 fingerprint: 37:d8:dc:8a:f7:86:78:45:da:33:44:a6:b1:ba:de:44:8d:8a:80:e4:7b:55:79:f9:6b:f6:31:76:8f:9f:30:f6 o = verisign, inc., ou = class 1 public primary certification authority sha-256 fingerprint: 51:84:7c:8c:bd:2e:9a:72:c9:1e:29:2d:2a:e2:47:d7:de:1e:3f:d2:70:54:7a:20:ef:7d:61:0f:38:b8:84:2c o = verisign, inc., ou = class 2 public primary certification authority - g2 sha-256 fingerprint: 3a:43...

NSS 3.28.1 release notes
notable changes in nss 3.28.1 the following ca certificates were removed cn = buypass class 2 ca 1 sha-256 fingerprint: 0f:4e:9c:dd:26:4b:02:55:50:d1:70:80:63:40:21:4f:e9:44:34:c9:b0:2f:69:7e:c7:10:fc:5f:ea:fb:5e:38 cn = root ca generalitat valenciana sha-256 fingerprint: 8c:4e:df:d0:43:48:f3:22:96:9e:7e:29:a4:cd:4d:ca:00:46:55:06:1c:16:e1:b0:76:42:2e:f3:42:ad:63:0e ou = rsa security 2048 v3 sha-256 fingerprint: af:8b:67:62:a1:e5:28:22:81:61:a9:5d:5c:55:9e:e2:66:27:8f:75:d7:9e:83:01:89:a5:03:50:6a:bd:6b:4c th...

NSS 3.28.4 release notes
bugs fixed in nss 3.28.4 bug 1344380 / out-of-bounds write in base64 encoding in nss (cve-2017-5461) bug 1345089 / drbg flaw in nss (cve-2017-5462) bug 1342358 - crash in tls13_destroykeyshares acknowledgements the nss development team would like to thank ronald crane and vladimir klebanov for responsibly disclosing the issues by providing advance copies of their research.

NSS 3.28 release notes
nss now uses the signature schemes definition in tls 1.3 (bug 1309446).

NSS 3.29.5 release notes
bugs fixed in nss 3.29.5 bug 1344380 / out-of-bounds write in base64 encoding in nss (cve-2017-5461) bug 1345089 / drbg flaw in nss (cve-2017-5462) acknowledgements the nss development team would like to thank ronald crane and vladimir klebanov for responsibly disclosing the issues by providing advance copies of their research.

NSS 3.30.1 release notes
bugs fixed in nss 3.30.1 bug 1344380 / out-of-bounds write in base64 encoding in nss (cve-2017-5461) acknowledgements the nss development team would like to thank ronald crane for responsibly disclosing the issue by providing advance copies of their research.

NSS 3.36.6 release notes
this is a patch release to fix cve-2018-12404 bugs fixed in nss 3.36.6 bug 1485864 - cache side-channel variant of the bleichenbacher attack (cve-2018-12404) bug 1389967 and bug 1448748 - fixes for mingw on x64 platforms.

NSS 3.37 release notes
the following ca certificates were removed: cn = s-trust universal root ca sha-256 fingerprint: d8:0f:ef:91:0a:e3:f1:04:72:3b:04:5c:ec:2d:01:9f:44:1c:e6:21:3a:df:15:67:91:e7:0c:17:90:11:0a:31 cn = tc trustcenter class 3 ca ii sha-256 fingerprint: 8d:a0:84:fc:f9:9c:e0:77:22:f8:9b:32:05:93:98:06:fa:5c:b8:11:e1:c8:13:f6:a1:08:c7:d3:36:b3:40:8e cn = tÜrktrust elektronik sertifika hizmet sağlayıcısı h5 sha-256 fingerprint: 49:35:1b:90:34:44:c1:85:cc:dc:5c:69:3d:24:d8:55:5c:b2:08:d6:a8:14:13:07:69:...

NSS 3.41 release notes
sha-256 fingerprint: a6c51e0da5ca0a9309d2e4c0e40c2af9107aae8203857fe198e3e769e343085c cn = certplus root ca g1 sha-256 fingerprint: 152a402bfcdf2cd548054d2275b39c7fca3ec0978078b0f0ea76e561a6c7433e cn = certplus root ca g2 sha-256 fingerprint: 6cc05041e6445e74696c4cfbc9f80f543b7eabbb44b4ce6f787c6a9971c42f17 cn = opentrust root ca g1 sha-256 fingerprint: 56c77128d98c18d91b4cfdffbc25ee9103d4758ea2abad826a90f3457d460eb4 cn = opentrust root ca g2 sha-256 fingerprint: 27995829fe6a7515c1bfe848f9c4761db16c225929257bf40d0894f29ea8baf2 cn = opentrust root ca g3 sha-256 fingerprint: b7c36231706e81078c367cb896198f1e32...

NSS 3.43 release notes
the following ca certificates were added: cn = emsign root ca - g1 sha-256 fingerprint: 40f6af0346a99aa1cd1d555a4e9cce62c7f9634603ee406615833dc8c8d00367 cn = emsign ecc root ca - g3 sha-256 fingerprint: 86a1ecba089c4a8d3bbe2734c612ba341d813e043cf9e8a862cd5c57a36bbe6b cn = emsign root ca - c1 sha-256 fingerprint: 125609aa301da0a249b97a8239cb6a34216f44dcac9f3954b14292f2e8c8608f cn = emsign ecc root ca - c3 sha-256 fingerprint: bc4d809b15189d78db3e1d8cf4f9726a795da1643ca5f1358e1ddb0edc0d7eb3 cn = hongkong post root ca 3 sha-256 fingerprint: 5a2fc03f0c83b090bbfa40604b0988446c7636183df9846e17101a447fb8efd6 the following ca certificates were removed: none bugs fixed in nss 3.43 bug 1528669 and bug...

NSS 3.45 release notes
it test code verbatim bug 1550022 - ensure nssutil3 gets built on android bug 1528174 - chacha20poly1305 should no longer modify output length on failure bug 1549382 - don't leak in pkcs#11 modules if c_getslotinfo() returns error bug 1551041 - fix builds using gcc < 4.3 on big-endian architectures bug 1554659 - add versioning to openbsd builds to fix link time errors using nss bug 1553443 - send session ticket only after handshake is marked as finished bug 1550708 - fix gyp scripts on solaris sparc so that libfreebl_64fpu_3.so builds bug 1554336 - optimize away unneeded loop in mpi.c bug 1559906 - fipstest: use ckm_tls12_master_key_derive instead of vendor specific mechanism bug 1558126 - tls_aes_256_gcm_sha384 should be marked as fips compatible bug 1555207 - helloretryrequ...

NSS 3.46 release notes
notable changes in nss 3.46 certificate authority changes the following ca certificates were removed: bug 1574670 - remove expired class 2 primary root certificate sha-256 fingerprint: 0f993c8aef97baaf5687140ed59ad1821bb4afacf0aa9a58b5d57a338a3afbcb bug 1574670 - remove expired utn-userfirst-client root certificate sha-256 fingerprint: 43f257412d440d627476974f877da8f1fc2444565a367ae60eddc27a412531ae bug 1574670 - remove expired deutsche telekom root ca 2 root certificate sha-256 fingerprint: b6191a50d0c3977f7da99bcdaac86a227daeb9679ec70ba3b0c9d92271c170d3 bug 1566569 - remove swisscom root ca 2 root certificate sha-256 fingerprint: f09b122c7114f4a09bd4ea4f4a99d558b46e4c25cd81140d29c05613914c3841 ...

NSS 3.47 release notes
on (cve-2019-11756) bug 1494063 - support tls exporter in tstclnt and selfserv bug 1581024 - heap overflow in nss utility "derdump" bug 1582343 - soft token mac verification not constant time bug 1578238 - handle invald tag sizes for ckm_aes_gcm bug 1576295 - check all bounds when encrypting with seed_cbc bug 1580286 - nss rejects tls 1.2 records with large padding with sha384 hmac bug 1577448 - create additional nested s/mime test messages for thunderbird bug 1399095 - allow nss-try to be used to test nspr changes bug 1267894 - libssl should allow selecting the order of cipher suites in clienthello bug 1581507 - fix unportable grep expression in test scripts bug 1234830 - [cid 1242894][cid 1242852] unused values bug 1580126 - fix build failure on aarch64_be while building freebl...

NSS 3.48 release notes
kdf default iteration count, by default for modern key4 storage, optionally for legacy key3.db storage bug 1590972 - use -std=c99 rather than -std=gnu99 bug 1590676 - fix build if arm doesn't support neon bug 1575411 - enable tls extended master secret by default bug 1590970 - ssl_settimefunc has incomplete coverage bug 1590678 - remove -wmaybe-uninitialized warning in tls13esni.c bug 1588244 - nss changes for delegated credential key strength checks bug 1459141 - add more cbc padding tests that missed nss 3.47 bug 1590339 - fix a memory leak in btoa.c bug 1589810 - fix uninitialized variable warnings from certdata.perl bug 1573118 - enable tls 1.3 by default in nss this bugzilla query returns all the bugs fixed in nss 3.48: https://bugzilla.mozilla.org/buglist.cgi?resolution=f...

NSS 3.49 release notes
bug 1605545 - memory leak in pk11install_platform_generate bug 1602288 - fix build failure due to missing posix signal.h bug 1588714 - implement checkarmsupport for win64/aarch64 bug 1585189 - nss database uses 3des instead of aes to encrypt db entries bug 1603257 - fix ubsan issue in softoken ckm_nss_chacha20_ctr initialization bug 1590001 - additional hrr tests (cve-2019-17023) bug 1600144 - treat clienthello with message_seq of 1 as a second clienthello bug 1603027 - test that esni is regenerated after helloretryrequest bug 1593167 - intermittent mis-reporting potential security risk sec_error_unknown_issuer bug 1535787 - fix automation/release/nss-release-helper.py on macos bug 1594933 - disable building dbm by default bug 1562548 - improve gcm perfomance on aarch32 this b...

NSS 3.52 release notes
bug 1624402 - fix compilation error in firefox android.

NSS 3.53 release notes
vsx vector instructions bug 1639033 - fix various compile warnings in nss bug 1640041 - fix a null pointer in security/nss/lib/ssl/sslencode.c:67 bug 1640042 - fix a null pointer in security/nss/lib/ssl/sslsock.c:4460 bug 1638289 - avoid multiple definitions of sha{256,384,512}_* symbols when linking libfreeblpriv3.so in firefox on ppc64le bug 1636389 - relocate deprecated seed algorithm bug 1637083 - lib/ckfw: no such file or directory.

nss tech note7
sample code sample code 4: pki encryption references rsa labs pkcs #1 web site rfc 3447: rsa pkcs #1 v2.1 poupou's blog: common question: how to encrypt using rsa ...

Overview of NSS
tls v1.3 (rfc 8446), tls v1.2 (rfc 5246), tls v1.1 (rfc 4346), tls v1 (rfc 2246).

NSS tools : certutil
id < 1> rsa 40defeeb522ade11090eacebaaf1196a172127df example domain administrator cert < 2> rsa 1d0b06f44f6c03842f7d4f4a1dc78b3bcd1b85a5 john smith user cert there are ways to narrow the keys listed in the search results: * to return a specific key, use the -n name argument with the name of the key.

NSS Tools certutil
a, c=us subject public key info: public key algorithm: pkcs #1 rsa encryption rsa public key: modulus: 00:da:53:23:58:00:91:6a:d1:a2:39:26:2f:06:3a: 38:eb:d4:c1:54:a3:62:00:b9:f0:7f:d6:00:76:aa: 18:da:6b:79:71:5b:d9:8a:82:24:07:ed:49:5b:33: bf:c5:79:7c:f6:22:a7:18:66:9f:ab:2d:33:03:ec: 63:eb:9d:0d:02:1b:da:32:ae:6c:d4:40:95:9f:b3: 44:8b:8e:8e:a3:ae:ad:08:38:4f:2e:53:e9:e1:3f: 8e:43:7f:51:61:b9:0f:f3:a6:25:1e:0b:93:74:8f: c6:13:a3:cd:51:40:84:0e:79:ea:b7:6b:d1:cc:6b: 78:d0:5d:da:be:2b:57:c2:6f exponent: 65537 (0x10001) signature algorithm: pkcs #1 md5 with rsa encryption signature: 44:15:e5:ae:c4:30:2c:cd:60:89:f1:1d:22:ed:5e:5b:10:c8: 7e:5f:56:8c:b4:00:12:ed:5f:a4:6a:12:c3:0d:01:03:09:f...

certutil
id < 1> rsa 40defeeb522ade11090eacebaaf1196a172127df example domain administrator cert < 2> rsa 1d0b06f44f6c03842f7d4f4a1dc78b3bcd1b85a5 john smith user cert there are ways to narrow the keys listed in the search results: o to return a specific key, use the -n name argument with the name of the key.

Scripting Java
using the javascript for..in construct, we can print out all these values: js> for (i in f) { print(i) } exists parentfile mkdir tostring wait [44 others] note that not only the methods of the file class are listed, but also the methods inherited from the base class java.lang.object (like wait).

Rebranding SpiderMonkey (1.8.5)
search for this text: mozjs185.pc "scroll down" a few lines until you see this line: > $@ && chmod 644 $@ that line should be modified to read back: > $brand.pc && chmod 644 $brand.pc "scroll down" a few lines until you see these lines: install:: $(pkg_config_files) @echo pkg_config_file: $(pkg_config_files) those two lines should be modified to read back: install:: $brand.pc @echo pkg_config_file: $brand.pc note: while it is possible to automate the manual editing process, this ha...

Hacking Tips
00000069bdcf in js::jit::docallfallback(jscontext*, js::jit::baselineframe*, js::jit::iccall_fallback*, uint32_t, js::value*, js::mutablehandlevalue) (cx=0x14f2640, frame=0x7fffffff6ad8, stub_=0x1798838, argc=1, vp=0x7fffffff6a88, res=jsval_void) at js/src/jit/baselineic.cpp:6113 #4 0x00007ffff7f41395 in <<jitframe_exit>> () #5 0x00007ffff7f42223 in <<jitframe_baselinestub>> () #6 0x00007ffff7f4423d in <<jitframe_baselinejs>> () #7 0x00007ffff7f4222e in <<jitframe_baselinestub>> () #8 0x00007ffff7f4326a in <<jitframe_baselinejs>> () #9 0x00007ffff7f38d5f in <<jitframe_entry>> () #10 0x00000000006a86de in enterbaseline(jscontext*, js::jit::enterjitdata&) (cx=0x14f2640, data=...) at js/src/jit/baselinejit.cpp:150 note, when you enable the unwinder, the current version of gdb (7.10.1) d...

Property cache
see bug 440834.

JSClass.flags
see also bug 527805 - removed jsclass_share_all_properties bug 571789 - removed jsclass_is_extended bug 638291 - removed jsclass_mark_is_trace bug 641025 - added jsclass_implements_barriers bug 702507 - removed jsclass_construct_prototype bug 758913 - removed jsclass_new_resolve_gets_start bug 766447 - added jsclass_is_domjsclass bug 792108 - added jsclass_emulates_undefined bug 993026 - removed jsclass_new_resolve bug 1097267 - removed jsclass_new_enumerate ...

JSID_IS_STRING
see also mxr id search for jsid_is_string mxr id search for jsid_to_string mxr id search for interned_string_to_jsid mxr id search for jsid_to_flat_string bug 609440 - added jsid_to_flat_string bug 1045900 - added interned_string_to_jsid ...

JSPropertySpec
to define an array of jspropertyspec, use js_psg, js_psgs, js_self_hosted_get, js_self_hosted_getset, and js_ps_end see also mxr id search for jspropertyspec jsfunctionspec jsnativewrapper js_defineproperties js_psg js_psgs js_self_hosted_get js_self_hosted_getset js_ps_end bug 766448 - changed type of getter and setter to wrapper bug 938728 - added selfhostedgetter and selfhostedsetter bug 958262 - changed type of getter and setter to union, and removed selfhostedgetter and selfhostedsetter.

JSXDRObjectOp
see also jsclass bug 726944 ...

JS_ASSERT_STRING_IS_FLAT
see also mxr id search for js_assert_string_is_flat js_stringisflat bug 609440 ...

JS_EnumerateResolvedStandardClasses
see also js_enumerateresolvedstandardclasses bug 884410 ...

JS_FORGET_STRING_FLATNESS
see also mxr id search for js_forget_string_flatness jsflatstring jsstring bug 609440 ...

JS_FileEscapedString
see also mxr id search for js_fileescapedstring bug 609440 ...

JS_FlattenString
example: // in a fallible situation jsflatstring *fstr = js_flattenstring(cx, str); if (!fstr) return false; js_assert(fstr == js_assert_string_is_flat(str)); // in an infallible situation, for the same 'str' const jschar *chars = js_getflatstringchars(fstr) js_assert(chars); see also mxr id search for js_flattenstring js_assert_string_is_flat js_forget_string_flatness bug 609440 ...

JS_GetContextPrivate
see also mxr id search for js_getcontextprivate mxr id search for js_setcontextprivate mxr id search for js_getsecondcontextprivate mxr id search for js_setsecondcontextprivate js_getruntimeprivate js_setruntimeprivate js_getcompartmentprivate js_setcompartmentprivate js_getprivate js_setprivate js_getinstanceprivate bug 714458 ...

JS_GetGCParameter
see also mxr id search for js_getgcparameter mxr id search for js_setgcparameter bug 474801 jsgc_bytes jsgc_number bug 474497 jsgc_max_code_cache_bytes this option no-longer exists js_getgcparameterforthread js_setgcparameterforthread bug 624229 jsgc_mode bug 631733 jsgc_unused_chunks bug 674480 jsgc_total_chunks bug 641025 jsgc_slice_time_budget bug 673551 jsgc_mark_stack_limit bug 765435 jsgc_high_frequency_time_limit jsgc_high...

JS_GetInternedStringChars
see also bug 1037869 bug 609440 ...

JS_GetStringChars
see also bug 609440 - removed js_getstringchars bug 1037869 - removed js_getstringcharsz ...

JS_InternJSString
see also mxr id search for js_internjsstring bug 609440 ...

JS_IsArrayObject
syntax bool js_isarrayobject(jscontext *cx, js::handlevalue value, bool *isarray); bool js_isarrayobject(jscontext *cx, js::handleobject obj, bool *isarray); // obsolete since jsapi 44 bool js_isarrayobject(jscontext *cx, js::handlevalue value); bool js_isarrayobject(jscontext *cx, js::handleobject obj); name type description cx jscontext * a context.

JS_NewFunction
syntax // added in spidermonkey 45 jsfunction * js_newfunction(jscontext *cx, jsnative call, unsigned nargs, unsigned flags, const char *name); // obsolete since jsapi 44 jsfunction * js_newfunctionbyid(jscontext *cx, jsnative call, unsigned nargs, unsigned flags, js::handle<jsid> id); // obsolete since jsapi 39 jsfunction * js_newfunction(jscontext *cx, jsnative call, unsigned nargs, unsigned flags, js::handle<jsobject*> parent, const char *name); jsfunction * js_newfunctionbyid(jscontext *cx, jsnative call, unsigned nargs, unsigned flags, js::handle<jsobject*> parent, js::handle<jsid> id); // added in spidermonkey 17 name ...

JS_PutEscapedString
see also mxr id search for js_putescapedstring mxr id search for js_putescapedflatstring bug 609440 ...

JS_SetScriptStackQuota
see also mxr id search for js_setscriptstackquota bug 644241 ...

JS_StringEqualsAscii
see also mxr id search for js_stringequalsascii mxr id search for js_flatstringequalsascii bug 609440 ...

JS_ValueToNumber
see also js_convertarguments js_convertvalue js_gettypename js_typeofvalue js_valuetoint32 js_valuetoecmaint32 bug 884410 ...

SpiderMonkey 1.8.5
strings js_comparestrings received a new function signature with bug 609440, allowing us to correctly propagate exceptions when the underlying functions to retrieve the characters in the string failed.

SpiderMonkey 1.8.7
strings js_comparestrings received a new function signature with bug 609440, allowing us to correctly propagate exceptions when the underlying functions to retrieve the characters in the string failed.

Life After XUL: Building Firefox Interfaces with HTML
work on this is being tracked in bug 1453783 and bug 1446829.

extIPreferenceBranch
see bug 481044 void reset() parameters return value examples var myext = application.extensions.get('myapplicationid'); function myfunc (event) { application.console.log('change!'); }; myext.prefs.get("myprefname").events.addlistener("change", myfunc); see also fuel (firefox), steel (thunderbird) and smile (seamonkey) known issues bug 488587 - function registered as fuel preference listener not ...

Creating a Python XPCOM component
defining the interface make a file named "nsipysimple.idl" to define the interface: #include "nsisupports.idl" [scriptable, uuid(2b324e9d-a322-44a7-bd6e-0d8c83d94883)] interface nsipysimple : nsisupports { attribute string yourname; void write( ); void change(in string avalue); }; this is the same as the nsisimple interface used here.

nsIRegistry
try { st.first(); do { var data = st.currentitem(); if( data instanceof ci.nsiregistrynode ) print("nsiregistrynode: " + data.nameutf8 + " (" + data.key + ")"); st.next(); } while( components.lastresult == 0 ); } catch(e) {} now, the output is something like: profiles (344) profiles/default (530) profiles/foo (1046) profiles/bar (1518) the number inside the parenthesis is the "key." you can use this key with the rest of the nsiregistry api (see mxr).

nsScriptableInputStream
class id 7225c040-a9bf-11d3-a197-0050041caf44 contractid @mozilla.org/scriptableinputstream;1 supported interfaces nsiscriptableinputstream, nsiinputstream remarks this component should be accessed via the xpcom component manager.

nsACString_internal
eveloper.mozilla.org/en/nscautostring" shape="rect" title="nscautostring"> <area alt="" coords="5,389,227,437" href="http://developer.mozilla.org/en/ns_lossyconvertutf16toascii" shape="rect" title="ns_lossyconvertutf16toascii"> <area alt="" coords="251,389,435,437" href="http://developer.mozilla.org/en/ns_convertutf16toutf8" shape="rect" title="ns_convertutf16toutf8"> <area alt="" coords="309,293,445,341" href="http://developer.mozilla.org/en/nsadoptingcstring" shape="rect" title="nsadoptingcstring"> </map> method overview constructors beginreading endreading beginwriting endwriting data length isempty isvoid isterminated charat operator[] first last countchar findchar equals equalsascii equalsliteral(const char ...

nsIAccessibleRole
role_checkbutton 44 represents a check box control.

nsICryptoHash
venience var path = "c:\\windows\\notepad.exe"; var f = components.classes["@mozilla.org/file/local;1"] .createinstance(components.interfaces.nsilocalfile); f.initwithpath(path); var istream = components.classes["@mozilla.org/network/file-input-stream;1"] .createinstance(components.interfaces.nsifileinputstream); // open for reading istream.init(f, 0x01, 0444, 0); var ch = components.classes["@mozilla.org/security/hash;1"] .createinstance(components.interfaces.nsicryptohash); // we want to use the sha256 algorithm ch.init(ch.sha256); // this tells updatefromstream to read the entire file const pr_uint32_max = 0xffffffff; ch.updatefromstream(istream, pr_uint32_max); // pass false here to get binary data back var hash = ch.finish(fal...

nsIDOMHTMLAudioElement
for example, specify 44100 for 44.1khz.

nsIDOMWindow
66 introduced gecko 1.0 deprecated gecko 44 inherits from: nsisupports last changed in gecko 7.0 (firefox 7.0 / thunderbird 7.0 / seamonkey 2.4) starting with firefox 44, this file is empty as its features were either no longer used or are only available from c++ code; see dom/base/nspidomwindow.h for those.

nsIEventListenerInfo
remarks nsieventlistenerinfo was introduced with bug 448602.

nsIEventListenerService
remarks nsieventlistenerservice was introduced with bug 448602.

nsIFactory
see bug 99144 for details.

nsIHttpChannel
warning: calling setrequestheader(), setreferrerwithpolicy() or setemptyrequestheader() while visiting request headers has undefined behavior until gecko 47 (firefox 47.0 / thunderbird 47.0 / seamonkey 2.44).

nsIInputStream
see bug 124465 for details.

nsIOutputStream
see bug 124465 for details.

nsIPromptService
constant value description button_pos_0_default 0 button_pos_1_default 16777216 button_pos_2_default 33554432 button_delay_enable button_delay_enable causes the buttons to be initially disabled.

nsISupports proxies
you may also use the defined flags which are defined in xpcom/threads/nsieventqueueservice.h#44.

nsIWebBrowserChrome
chrome_window_raised 33554432 represent special cases.

nsIWebBrowserPersist
components.interfaces.nsiioservice).newuri(httploc, null, null); //new file object var obj_targetfile = components.classes["@mozilla.org/file/local;1"].createinstance(components.interfaces.nsilocalfile); //set file with path obj_targetfile.initwithpath("c:\\temp\\test.pdf"); //if file doesn't exist, create if(!obj_targetfile.exists()) { obj_targetfile.create(0x00,0644); } //new persistence object var obj_persist = components.classes["@mozilla.org/embedding/browser/nswebbrowserpersist;1"].createinstance(components.interfaces.nsiwebbrowserpersist); // with persist flags if desired const nsiwbp = components.interfaces.nsiwebbrowserpersist; const flags = nsiwbp.persist_flags_replace_existing_files; obj_persist.persistflags = flags | n...

nsIWinTaskbar
see bug 744992 for details and to track progress on a fix.

nsIXMLHttpRequest
you only want this if your url is to a zip file or some file you want to download and make a nsiarraybufferinputstream out of it or something xhr.send(null); } xhr('https://www.gravatar.com/avatar/eb9895ade1bd6627e054429d1e18b576?s=24&d=identicon&r=pg&f=1', data => { services.prompt.alert(null, 'xhr success', data); var file = os.path.join(os.constants.path.desktopdir, "test.png"); var promised = os.file.writeatomic(file, new uint8array(data)); promised.then( function() { alert('succesfully saved image to desktop') }, function(ex) { alert('failed ...

nsMsgFolderFlagType
[scriptable,uuid(fbe7cba8-3141-4c44-9660-99af6b53f27e)] interface nsmsgfolderflags { /** * @name folder type flags * these flags define the type of folder.

nsMsgSearchAttrib
pager = 27; const nsmsgsearchattribvalue mobile = 28; const nsmsgsearchattribvalue city = 29; const nsmsgsearchattribvalue street = 30; const nsmsgsearchattribvalue title = 31; const nsmsgsearchattribvalue organization = 32; const nsmsgsearchattribvalue department = 33; // 34 - 43, reserved for ab / ldap; const nsmsgsearchattribvalue hasattachmentstatus = 44; const nsmsgsearchattribvalue junkstatus = 45; const nsmsgsearchattribvalue junkpercent = 46; const nsmsgsearchattribvalue junkscoreorigin = 47; const nsmsgsearchattribvalue label = 48; /* mail only...can search by label */ const nsmsgsearchattribvalue hdrproperty = 49; // uses nsimsgsearchterm::hdrproperty const nsmsgsearchattribvalue folderflag = 50; // uses nsimsg...

nsMsgSearchTypeValue
defined in comm-central/ mailnews/ base/ search/ public/ nsmsgsearchcore.idl used to specify type of search to be performed [scriptable,uuid(964b7f32-304e-11d3-ae13-00a0c900d445)] interface nsmsgsearchtype { const nsmsgsearchtypevalue none = 0; const nsmsgsearchtypevalue rootdse = 1; const nsmsgsearchtypevalue normal = 2; const nsmsgsearchtypevalue ldapvlv = 3; const nsmsgsearchtypevalue namecompletion = 4; }; ...

nsMsgSearchWidgetValue
defined in comm-central/ mailnews/ base/ search/ public/ nsmsgsearchcore.idl fes use this to help build the search dialog box typedef long nsmsgsearchwidgetvalue; /* fes use this to help build the search dialog box */ [scriptable,uuid(903dd2e8-304e-11d3-92e6-00a0c900d445)] interface nsmsgsearchwidget { const nsmsgsearchwidgetvalue text = 0; const nsmsgsearchwidgetvalue date = 1; const nsmsgsearchwidgetvalue menu = 2; const nsmsgsearchwidgetvalue int = 3; /* added to account for age in days which requires an integer field */ const nsmsgsearchwidgetvalue none = 4; }; ...

XPCOM primitive
interface nsisupportsfloat : nsisupportsprimitive { attribute float data; string tostring(); }; double nsisupportsdouble @mozilla.org/supports-double;1 [scriptable, uuid(b32523a0-4ac0-11d3-baea-00805f8a5dd7)] interface nsisupportsdouble : nsisupportsprimitive { attribute double data; string tostring(); }; voidptr nsisupportsvoid @mozilla.org/supports-void;1 [scriptable, uuid(464484f0-568d-11d3-baf8-00805f8a5dd7)] interface nsisupportsvoid : nsisupportsprimitive { [noscript] attribute voidptr data; string tostring(); }; nsisupports nsisupportsinterfacepointer @mozilla.org/supports-interface-pointer;1 [scriptable, uuid(995ea724-1dd1-11b2-9211-c21bdd3e7ed0)] interface nsisupportsinterfacepointer : nsisupportsprimitive { attribute nsisupports data; attribute...

Address book sync client design
this interface is as follows: #include "nsisupports.idl" #include "nsrootidl.idl" #include "nsifilespec.idl" [scriptable, uuid(e0ed29e0-098a-11d4-8fd6-00a024a7d144)] interface nsiabsynclistener : nsisupports { /** * notify the observer that the ab sync authorization operation has begun.

Index
44 main windows thunderbird the base chrome directory of thunderbird can sometimes appear confusing when you're just beginning to look at it.

customDBHeaders Preference
extension</em:description> <em:creator>garrett comeaux</em:creator> </description> </rdf> build process: [gcomeaux@kyle tbird-ext]$ cd superfluous/ [gcomeaux@kyle superfluous]$ make zip superfluous.xpi chrome/ chrome.manifest chrome/content/ chrome/content/superfluous.js chrome/content/superfluous_overlay.xul install.rdf adding: chrome/ (stored 0%) adding: chrome.manifest (deflated 44%) adding: chrome/content/ (stored 0%) adding: chrome/content/superfluous.js (deflated 57%) adding: chrome/content/superfluous_overlay.xul (deflated 44%) adding: install.rdf (deflated 50%) end result ultimately, you want to be able to compose a message like this: and see the superfluous column displayed in your inbox like this: thanks many thanks go out to the thunderbird develop...

Using COM from js-ctypes
= parseint(jsarr_pieces[j], 16); }; return guid; } // constants let coinit_multithreaded = 0; let coinit_apartmentthreaded = 2; let clsctx_all = 0x17; let clsid_spvoice = clsidfromarr(['0x96749377', '0x3391', '0x11d2', '0x9e', '0xe3', '0x00', '0xc0', '0x4f', '0x79', '0x73', '0x96']); let iid_ispvoice = iidfromarr(['0x6c44df74', '0x72b9', '0x4992', '0xa1', '0xec', '0xef', '0x99', '0x6e', '0x04', '0x22', '0xd4']); let spf_default = 0; function main() { let spvoice; let spvoiceptr; try { // msdn docs tell us ot use coinitex instead of coinit, and default is 0 // which is coinit_multithreaded but it wouldnt work so i used ...

Debugger.Frame - Firefox Developer Tools
source metadata generated from file: js/src/doc/debugger/debugger.frame.md watermark: sha256:b1894f88b76b7afd661f3044a05690d76d1498c54c596ca729c6ee0d150d2da1 changeset: e91b2c85aacd ...

Deprecated tools - Firefox Developer Tools
web audio editor bugzilla issue: bug 1403944 removed as of firefox 67 description the web audio editor allowed you to examine an audio context constructed in the page and provided a visualization of its graph.

JSON viewer - Firefox Developer Tools
the json viewer is new in firefox 44.

Migrating from Firebug - Firefox Developer Tools
this feature is not available yet within the network monitor, but it's requested in bug 1334408.

Network request details - Firefox Developer Tools
e entire header is copied in json format, giving you something like this (after running the results through a json validator): { "response headers (1.113 kb)": { "headers": [ { "name": "accept-ranges", "value": "bytes" }, { "name": "age", "value": "0" }, { "name": "backend-timing", "value": "d=74716 t=1560258099074460" }, { "name": "cache-control", "value": "private, must-revalidate, max-age=0" }, { "name": "content-disposition", "value": "inline; filename=api-result.js" }, { "name": "content-encoding", "value": "gzip" }, { "name": "content-length", "value": "673" }, { "name": "...

Examine and edit HTML - Firefox Developer Tools
from firefox 44, pressing the keyboard shortcut s will also scroll the selected node into view.

Rich output - Firefox Developer Tools
for example, by expanding the array in the above list, i get the following: console.log(todolist) (4) […] ​ 0: object { status: "done", description: "morning pages", datecreated: 1552404478137 } ​ 1: object { status: "in progress", description: "refactor styles", datecreated: 1552404493169 } ​ 2: object { status: "to do", description: "create feedback form", datecreated: 1552404512630 } ​ 3: object { status: "to do", description: "normalize table", datecreated: 1552404533790 } ​ length: 4 ​ <prototype>: array [] debugger eval code:1:9 undefined highlighting and inspecti...

AudioContext.getOutputTimestamp() - Web APIs
for androidsafari on iossamsung internetgetoutputtimestamp experimentalchrome full support 57edge full support ≤79firefox full support 70ie no support noopera full support 44safari no support nowebview android full support 57chrome android full support 57firefox android no support noopera android full support 43safari ios no suppor...

AudioParam.cancelAndHoldAtTime() - Web APIs
— 56alternate name alternate name uses the non-standard name: cancelvaluesandholdattime()edge full support ≤79firefox no support noie no support noopera full support 44 full support 44 no support ?

AudioParam.maxValue - Web APIs
the default value of maxvalue is the maximum positive single-precision floating-point value (+340,282,346,638,528,859,811,704,183,484,516,925,440).

AudioParam.minValue - Web APIs
the default value of minvalue is the minimum negative single-precision floating-point value (-340,282,346,638,528,859,811,704,183,484,516,925,440).

BaseAudioContext.createWaveShaper() - Web APIs
amount : 50, n_samples = 44100, curve = new float32array(n_samples), deg = math.pi / 180, i = 0, x; for ( ; i < n_samples; ++i ) { x = i * 2 / n_samples - 1; curve[i] = ( 3 + k ) * x * 20 * deg / ( math.pi + k * math.abs(x) ); } return curve; }; ...

BlobEvent.timecode - Web APIs
ie no support noopera full support 44safari no support nowebview android full support 57chrome android full support 57firefox android ?

CSSUnparsedValue.CSSUnparsedValue() - Web APIs
examples let value = new cssunparsedvalue( ['4deg'] ), values = new cssunparsedvalue( ['1em', '#445566', '-45px'] ); console.log( value ); // cssunparsedvalue {0: "4deg", length: 1} console.log( values ); // cssunparsedvalue {0: "1em", 1: "#445566", 2: "-45px", length: 3} specifications specification status comment css typed om level 1the definition of 'cssunparsedvalue' in that specification.

CSSUnparsedValue.length - Web APIs
examples in this example we employ the cssunparsedvalue.cssunparsedvalue() constructor, then query the length: let values = new cssunparsedvalue( ['1em', '#445566', '-45px'] ); console.log( values.length ) // 3 specifications specification status comment css typed om level 1the definition of 'length' in that specification.

Manipulating video using canvas - Web APIs
<!doctype html> <html> <head> <style> body { background: black; color:#cccccc; } #c2 { background-image: url(media/foo.png); background-repeat: no-repeat; } div { float: left; border :1px solid #444444; padding:10px; margin: 10px; background:#3b3b3b; } </style> </head> <body> <div> <video id="video" src="media/video.mp4" controls="true" crossorigin="anonymous"/> </div> <div> <canvas id="c1" width="160" height="96"></canvas> <canvas id="c2" width="160" height="96"></canvas> </div> <script type="text/javascript" src="p...

DOMHighResTimeStamp - Web APIs
// reduced time precision with `privacy.resistfingerprinting` enabled event.timestamp; // 1519129853500 // 1519129858900 // 1519129864400 // ...

DOMRectReadOnly.fromRect() - Web APIs
oidopera for androidsafari on iossamsung internetfromrect() static functionchrome full support 57edge full support 79firefox full support 69ie no support noopera full support 44safari full support 10.1webview android full support 57chrome android full support 57firefox android no support noopera android full support 43safari ios full ...

Document.documentURIObject - Web APIs
see bug 324464's comments for details.

Document.fonts - Web APIs
t 47safari full support 10webview android full support 60chrome android full support 60firefox android full support yesopera android full support 44safari ios full support 10samsung internet android full support 5.0legend full support full support no support no supportuser must explicitly enable this feature.user must ...

Event.timeStamp - Web APIs
// reduced time precision with `privacy.resistfingerprinting` enabled event.timestamp; // 1519129853500 // 1519129858900 // 1519129864400 // ...

File.lastModified - Web APIs
// reduced time precision with `privacy.resistfingerprinting` enabled somefile.lastmodified; // 1519129853500 // 1519129858900 // 1519129864400 // ...

File.lastModifiedDate - Web APIs
// reduced time precision with `privacy.resistfingerprinting` enabled somefile.lastmodifieddate.gettime(); // 1519129853500 // 1519129858900 // 1519129864400 // ...

FontFace.display - Web APIs
port 47safari full support 11webview android full support 60chrome android full support 60firefox android no support noopera android full support 44safari ios no support nosamsung internet android full support 8.0legend full support full support no support no support compatibility unkn...

FontFaceSetLoadEvent.FontFaceSetLoadEvent() - Web APIs
opera full support 44safari ?

FontFaceSetLoadEvent - Web APIs
opera full support 44safari ?

HTMLDocument - Web APIs
ono,monospace" fill="#4d4e53" text-anchor="middle" alignment-baseline="middle">document</text></a><polyline points="346,25 356,20 356,30 346,25" stroke="#d4dde4" fill="none"/><line x1="356" y1="25" x2="386" y2="25" stroke="#d4dde4"/><a xlink:href="/docs/web/api/htmldocument" target="_top"><rect x="386" y="1" width="120" height="50" fill="#f4f7f8" stroke="#d4dde4" stroke-width="2px" /><text x="446" y="30" font-size="12px" font-family="consolas,monaco,andale mono,monospace" fill="#4d4e53" text-anchor="middle" alignment-baseline="middle">htmldocument</text></a></svg></div> a:hover text { fill: #0095dd; pointer-events: all;} for the purposes of web development, you can generally think of htmldocument as an alias for document, upon which htmldocument is based.

accessKeyLabel - Web APIs
pull w3c/html#144, issue w3c/html#99, wicg discussion.

HTMLHyperlinkElementUtils.host - Web APIs
syntax string = object.host; object.host = string; examples var anchor = document.createelement("a"); anchor.href = "https://developer.mozilla.org/htmlhyperlinkelementutils.host" anchor.host == "developer.mozilla.org" anchor.href = "https://developer.mozilla.org:443/htmlhyperlinkelementutils.host" anchor.host == "developer.mozilla.org" // the port number is not included because 443 is the scheme's default port anchor.href = "https://developer.mozilla.org:4097/htmlhyperlinkelementutils.host" anchor.host == "developer.mozilla.org:4097" specifications specification status comment html living standardthe definition of 'htmlhyperlinke...

HTMLHyperlinkElementUtils.origin - Web APIs
the htmlhyperlinkelementutils.origin read-only property is a usvstring containing the unicode serialization of the origin of the represented url; that is: for url using the http or https, the scheme followed by '://', followed by the domain, followed by ':', followed by the port (the default port, 80 and 443 respectively, if explicitely specified); for url using file: scheme, the value is browser dependant; for url using the blob: scheme, the origin of the url following blob:.

HTMLHyperlinkElementUtils.port - Web APIs
syntax string = object.port; object.port = string; examples // let's an <a id="myanchor" href="https://developer.mozilla.org:443/docs/htmlhyperlinkelementutils.port"> element be in the document var anchor = document.getelementbyid("myanchor"); var result = anchor.port; // returns:'443' specifications specification status comment html living standardthe definition of 'htmlhyperlinkelementutils.port' in that specification.

HTMLInputElement.stepDown() - Web APIs
try setting the value to 44, which is not valid.

HTMLInputElement.webkitdirectory - Web APIs
for example, consider this file system: photoalbums birthdays jamie's 1st birthday pic1000.jpg pic1004.jpg pic1044.jpg don's 40th birthday pic2343.jpg pic2344.jpg pic2355.jpg pic2356.jpg vacations mars pic5533.jpg pic5534.jpg pic5556.jpg pic5684.jpg pic5712.jpg if the user chooses photoalbums, then the list reported by files will contain file objects fo...

HTMLMediaElement - Web APIs
for example, 44100 samples per second is the sample rate used by cd audio.

IDBCursor - Web APIs
(bug 891944) next : "next" : the cursor shows all records, including duplicates.

IIRFilterNode() - Web APIs
examples let feedforward = [0.00020298, 0.0004059599, 0.00020298]; let feedbackward = [1.0126964558, -1.9991880801, 0.9873035442]; const audiocontext = window.audiocontext || window.webkitaudiocontext; const audioctx = new audiocontext(); const iirfilter = new iirfilternode(audioctx, { feedforward: feedforward, feedback: feedbackward }); specifications specification status comment web audio apithe definition of 'iirfilternode()' in that specification.

ImageCapture.takePhoto() - Web APIs
opera android full support 44 full support 44 no support 43 — 44notes notes photosettings argument not supported.safari ios ?

InputEvent.dataTransfer - Web APIs
port 47safari no support nowebview android full support 60chrome android full support 60firefox android full support 67opera android full support 44safari ios no support nosamsung internet android full support 8.0legend full support full support no support no supportexperimental.

InputEvent.getTargetRanges() - Web APIs
rt 47safari full support 10.1webview android full support 60chrome android full support 60firefox android no support noopera android full support 44safari ios full support 10.3samsung internet android full support 8.0legend full support full support no support no supportexperimental.

IntersectionObserver.root - Web APIs
observer.root.style.border = "2px solid #44aa44"; specifications specification status comment intersection observerthe definition of 'intersectionobserver' in that specification.

Location: host - Web APIs
syntax string = object.host; object.host = string; examples var anchor = document.createelement("a"); anchor.href = "https://developer.mozilla.org/location.host" anchor.host == "developer.mozilla.org" anchor.href = "https://developer.mozilla.org:443/location.host" anchor.host == "developer.mozilla.org" // the port number is not included because 443 is the scheme's default port anchor.href = "https://developer.mozilla.org:4097/location.host" anchor.host == "developer.mozilla.org:4097" specifications specification status comment html living standardthe definition of 'host' in that specification.

Location: origin - Web APIs
the origin read-only property of the location interface is a usvstring containing the unicode serialization of the origin of the represented url; that is: for url using the http or https, the scheme followed by '://', followed by the domain, followed by ':', followed by the port (the default port, 80 and 443 respectively, if explicitely specified); for url using file: scheme, the value is browser dependant; for url using the blob: scheme, the origin of the url following blob:.

Location: port - Web APIs
syntax string = object.port; object.port = string; examples // let's an <a id="myanchor" href="https://developer.mozilla.org:443/docs/location.port"> element be in the document var anchor = document.getelementbyid("myanchor"); var result = anchor.port; // returns:'443' specifications specification status comment html living standardthe definition of 'location.port' in that specification.

MediaDevices.ondevicechange - Web APIs
let videoelement = document.getelementbyid("video"); let logelement = document.getelementbyid("log"); function log(msg) { logelement.innerhtml += msg + "<br>"; } document.getelementbyid("startbutton").addeventlistener("click", function() { navigator.mediadevices.getusermedia({ video: { width: 160, height: 120, framerate: 30 }, audio: { samplerate: 44100, samplesize: 16, volume: 0.25 } }).then(stream => { videoelement.srcobject = stream; updatedevicelist(); }) .catch(err => log(err.name + ": " + err.message)); }, false); we set up global variables that contain references to the <ul> elements that are used to list the audio and video devices: let audiolist = document.getelementbyid("audiolist"); let vide...

MediaTrackSettings.sampleRate - Web APIs
common values include 44,100 (standard cd audio), 48,000 (standard digital audio), 96,000 (commonly used in audio mastering and post-production), and 192,000 (used for high-resolution audio in professional recording and mastering sessions).

Using the Media Capabilities API - Web APIs
<option>video/webm; codecs=vp9</option> <option>video/mp4; codecs=avc1</option> <option>video/mp4; codecs=avc1.420034</option> <option>video/ogg; codecs=theora</option> <option>invalid</option> </select> </li> <li> <label for="size">select a size</label> <select id="size"> <option>7680x4320</option> <option>3840x2160</option> <option>2560x1440</option> <option>1920x1080</option> <option>1280x720</option> <option selected>800x600</option> <option>640x480</option> <option>320x240</option> <option value=" x ">none</option> </select> </li> <li> <label for="framerate">select a framerate</label> <select id="framerate"> <option>60</option> <option>50</option> <option>30</o...

Transcoding assets for Media Source Extensions - Web APIs
run the following commands (shown with sample output): $ python mp4-dash-encode.py -b 5 -v bunny_fragmented.mp4 encoding 5 bitrates, min bitrate = 500.0 max bitrate = 2000.0 media source: video: resolution=640x360 encoding bitrate: 500, resolution: 256x144 encoding bitrate: 875, resolution: 384x216 encoding bitrate: 1250, resolution: 480x270 encoding bitrate: 1625, resolution: 560x316 encoding bitrate: 2000, resolution: 640x360 $ python mp4-dash.py video_0* parsing media file 1: video_00500.mp4 parsing media file 2: video_00875.mp4 parsing media file 3: video_01250.mp4 parsing media file 4: video_01625.mp4 parsing media file 5: video_02000.mp4 spl...

Node.isEqualNode() - Web APIs
html <div>this is the first element.</div> <div>this is the second element.</div> <div>this is the first element.</div> <p id="output"></p> css #output { width: 440px; border: 2px solid black; border-radius: 5px; padding: 10px; margin-top: 20px; display: block; } javascript let output = document.getelementbyid("output"); let divlist = document.getelementsbytagname("div"); output.innerhtml += "div 0 equals div 0: " + divlist[0].isequalnode(divlist[0]) + "<br/>"; output.innerhtml += "div 0 equals div 1: " + divlist[0].isequalnode(divlist[1]) + ...

Node.isSameNode() - Web APIs
html <div>this is the first element.</div> <div>this is the second element.</div> <div>this is the first element.</div> <p id="output"></p> css #output { width: 440px; border: 2px solid black; border-radius: 5px; padding: 10px; margin-top: 20px; display: block; } javascript let output = document.getelementbyid("output"); let divlist = document.getelementsbytagname("div"); output.innerhtml += "div 0 same as div 0: " + divlist[0].issamenode(divlist[0]) + "<br/>"; output.innerhtml += "div 0 same as div 1: " + divlist[0].issamenode(divlist[1]) + ...

Notifications API - Web APIs
note: as of firefox 44, the permissions for notifications and push have been merged.

OfflineAudioContext.startRendering() - Web APIs
note: for a working example, see our offline-audio-context-promise github repo (see the source code too.) // define online and offline audio context var audioctx = new audiocontext(); var offlinectx = new offlineaudiocontext(2,44100*40,44100); source = offlinectx.createbuffersource(); // use xhr to load an audio track, and // decodeaudiodata to decode it and offlineaudiocontext to render it function getdata() { request = new xmlhttprequest(); request.open('get', 'viper.ogg', true); request.responsetype = 'arraybuffer'; request.onload = function() { var audiodata = request.response; audioctx.decodeau...

OfflineAudioContext - Web APIs
note: for a working example, see our offline-audio-context-promise github repo (see the source code too.) // define online and offline audio context var audioctx = new audiocontext(); var offlinectx = new offlineaudiocontext(2,44100*40,44100); source = offlinectx.createbuffersource(); // use xhr to load an audio track, and // decodeaudiodata to decode it and offlineaudiocontext to render it function getdata() { request = new xmlhttprequest(); request.open('get', 'viper.ogg', true); request.responsetype = 'arraybuffer'; request.onload = function() { var audiodata = request.response; audioctx.decodeau...

OscillatorNode.OscillatorNode() - Web APIs
its default is 440.

OscillatorNode.detune - Web APIs
// create web audio api context var audioctx = new (window.audiocontext || window.webkitaudiocontext)(); // create oscillator node var oscillator = audioctx.createoscillator(); oscillator.type = 'square'; oscillator.frequency.setvalueattime(440, audioctx.currenttime); // value in hertz oscillator.detune.setvalueattime(100, audioctx.currenttime); // value in cents oscillator.start(); specifications specification status comment web audio apithe definition of 'detune' in that specification.

OscillatorNode.onended - Web APIs
// create web audio api context var audioctx = new (window.audiocontext || window.webkitaudiocontext)(); // create oscillator node var oscillator = audioctx.createoscillator(); oscillator.type = 'square'; oscillator.frequency.value = 440; // value in hertz oscillator.start(); // start the tone playing oscillator.stop(5); // the tone will stop again in 5 seconds.

OscillatorNode.type - Web APIs
// create web audio api context var audioctx = new (window.audiocontext || window.webkitaudiocontext)(); // create oscillator node var oscillator = audioctx.createoscillator(); oscillator.type = 'square'; oscillator.frequency.setvalueattime(440, audioctx.currenttime); // value in hertz oscillator.start(); specifications specification status comment web audio apithe definition of 'type' in that specification.

PaymentAddress.addressLine - Web APIs
for example, the addressline array for the mozilla space in london would have the following entries: example showing addressline entries for an address in london index addressline[] value 0 metal box factory 1 suite 441, 4th floor 2 30 great guildford street these, combined with additional values for other properties of the paymentaddress, would represent the full address, which is: mozilla metal box factory suite 441, 4th floor 30 great guildford street london se1 0hs united kingdom specifications specification status comment payment request apithe definition ...

Permissions.query() - Web APIs
note: as of firefox 44, the permissions for notifications and push have been merged.

Permissions.revoke() - Web APIs
note: as of firefox 44, the permissions for notifications and push have been merged.

Using the Permissions API - Web APIs
at the moment, implementation of the api is at an early stage, so support in browsers is pretty spotty: it can only be found in chrome 44 and later and firefox 43 and later.

PushManager.hasPermission() - Web APIs
full support 17firefox full support 44notes full support 44notes notes extended support releases (esr) before firefox 78 esr do not support service workers and the push api.ie no support noopera full support 29safari no support nowebview android ...

PushManager.permissionState() - Web APIs
note: as of firefox 44, the permissions for notifications and push have been merged.

PushMessageData.arrayBuffer() - Web APIs
desktopmobilechromeedgefirefoxinternet exploreroperasafariandroid webviewchrome for androidfirefox for androidopera for androidsafari on iossamsung internetarraybuffer experimentalchrome full support 50edge full support ≤79firefox full support 44notes full support 44notes notes extended support releases (esr) before firefox 78 esr do not support service workers and the push api.ie no support noopera full support 37safari no support nowebview android ...

PushMessageData.blob() - Web APIs
desktopmobilechromeedgefirefoxinternet exploreroperasafariandroid webviewchrome for androidfirefox for androidopera for androidsafari on iossamsung internetblob experimentalchrome full support 50edge full support ≤79firefox full support 44notes full support 44notes notes extended support releases (esr) before firefox 78 esr do not support service workers and the push api.ie no support noopera full support 37safari no support nowebview android ...

PushMessageData.json() - Web APIs
desktopmobilechromeedgefirefoxinternet exploreroperasafariandroid webviewchrome for androidfirefox for androidopera for androidsafari on iossamsung internetjson experimentalchrome full support 50edge full support ≤79firefox full support 44notes full support 44notes notes extended support releases (esr) before firefox 78 esr do not support service workers and the push api.ie no support noopera full support 37safari no support nowebview android ...

PushMessageData.text() - Web APIs
desktopmobilechromeedgefirefoxinternet exploreroperasafariandroid webviewchrome for androidfirefox for androidopera for androidsafari on iossamsung internettext experimentalchrome full support 50edge full support ≤79firefox full support 44notes full support 44notes notes extended support releases (esr) before firefox 78 esr do not support service workers and the push api.ie no support noopera full support 37safari no support nowebview android ...

PushSubscription.expirationTime - Web APIs
support 47safari no support nowebview android no support nochrome android full support 60firefox android no support noopera android full support 44safari ios no support nosamsung internet android full support 8.0legend full support full support no support no support ...

PushSubscription.getKey() - Web APIs
desktopmobilechromeedgefirefoxinternet exploreroperasafariandroid webviewchrome for androidfirefox for androidopera for androidsafari on iossamsung internetgetkey()chrome full support 42edge full support 16firefox full support 44notes full support 44notes notes extended support releases (esr) before firefox 78 esr do not support service workers and the push api.ie no support noopera full support 29safari no support nowebview android ...

PushSubscription.options - Web APIs
desktopmobilechromeedgefirefoxinternet exploreroperasafariandroid webviewchrome for androidfirefox for androidopera for androidsafari on iossamsung internetoptionschrome full support 42edge full support 16firefox full support 44notes full support 44notes notes extended support releases (esr) before firefox 78 esr do not support service workers and the push api.ie no support noopera full support 29safari no support nowebview android ...

Push API - Web APIs
note: as of gecko 44, the allowed quota of push messages per application is not incremented when a new notification fires, when another is still visible, for a period of three seconds.

RTCIceCandidate.address - Web APIs
usage notes consider this sdp attribute line (a-line) which describes an ice candidate: a=candidate:4234997325 1 udp 2043278322 192.168.0.56 44323 typ host the fifth field, "192.168.0.56" is the ip address in this candidate's a-line string.

RTCIceCandidate.component - Web APIs
usage notes consider this sdp attribute line (a-line): a=candidate:4234997325 1 udp 2043278322 192.168.0.56 44323 typ host this is an ice candidate a-line, whose foundation is 4234997325.

RTCIceCandidate.foundation - Web APIs
usage notes consider this sdp attribute line (a-line) which describes an ice candidate: a=candidate:4234997325 1 udp 2043278322 192.168.0.56 44323 typ host the field "4234997325" is the foundation.

RTCIceCandidate.priority - Web APIs
usage notes consider this sdp attribute line (a-line) which describes an ice candidate: a=candidate:4234997325 1 udp 2043278322 192.168.0.56 44323 typ host the priority is the number after the protocol, so it's the fourth field in the candidate string.

RTCIceCandidate.protocol - Web APIs
usage notes here's an example candidate a-line from an ice transaction: a=candidate:4234997325 1 udp 2043278322 192.168.0.56 44323 typ host the third field, "udp", is the protocol type, indicating that the candidate would use the udp transport protocol.

RTCSessionDescription.sdp - Web APIs
syntax var value = sessiondescription.sdp; sessiondescription.sdp = value; value the value is a domstring containing an sdp message like this one: v=0 o=alice 2890844526 2890844526 in ip4 host.anywhere.com s= c=in ip4 host.anywhere.com t=0 0 m=audio 49170 rtp/avp 0 a=rtpmap:0 pcmu/8000 m=video 51372 rtp/avp 31 a=rtpmap:31 h261/90000 m=video 53000 rtp/avp 32 a=rtpmap:32 mpv/90000 example // the remote description has been set previously on pc, an rtcpeerconnection alert(pc.remotedescription.sdp); specifications specification status comment webrtc 1.0: real-time communication between browsersthe definition of 'rtcsessiondescriptio...

RsaPssParams - Web APIs
rfc 3447 says that "typical salt lengths" are either 0 or the length of the output of the digest algorithm that was selected when this key was generated.

SVGEllipseElement - Web APIs
e" fill="#4d4e53" text-anchor="middle" alignment-baseline="middle">svggeometryelement</text></a><polyline points="81,89 71,84 71,94 81,89" stroke="#d4dde4" fill="none"/><line x1="71" y1="89" x2="41" y2="89" stroke="#d4dde4"/><a xlink:href="/docs/web/api/svgellipseelement" target="_top"><rect x="-129" y="65" width="170" height="50" fill="#f4f7f8" stroke="#d4dde4" stroke-width="2px" /><text x="-44" y="94" font-size="12px" font-family="consolas,monaco,andale mono,monospace" fill="#4d4e53" text-anchor="middle" alignment-baseline="middle">svgellipseelement</text></a></svg></div> a:hover text { fill: #0095dd; pointer-events: all;} properties this interface also inherits properties from its parent interface, svggeometryelement.

SVGPolygonElement - Web APIs
e" fill="#4d4e53" text-anchor="middle" alignment-baseline="middle">svggeometryelement</text></a><polyline points="81,89 71,84 71,94 81,89" stroke="#d4dde4" fill="none"/><line x1="71" y1="89" x2="41" y2="89" stroke="#d4dde4"/><a xlink:href="/docs/web/api/svgpolygonelement" target="_top"><rect x="-129" y="65" width="170" height="50" fill="#f4f7f8" stroke="#d4dde4" stroke-width="2px" /><text x="-44" y="94" font-size="12px" font-family="consolas,monaco,andale mono,monospace" fill="#4d4e53" text-anchor="middle" alignment-baseline="middle">svgpolygonelement</text></a></svg></div> a:hover text { fill: #0095dd; pointer-events: all;} properties this interface doesn't implement any specific properties, but inherits properties from its parent, svggeometryelement and also implements prope...

Using the Screen Capture API - Web APIs
this could be refined further by specifying additional information for each of audio and video: const gdmoptions = { video: { cursor: "always" }, audio: { echocancellation: true, noisesuppression: true, samplerate: 44100 } } in this example the cursor will always be visible in the capture, and the audio track should ideally have noise suppression and echo cancellation features enabled, as well as an ideal audio sample rate of 44.1khz.

Selection.selectionLanguageChange() - Web APIs
it was removed in bug 949445 and should not be used.

Using Service Workers - Web APIs
note: as of firefox 44, when appcache is used to provide offline support for a page a warning message is now displayed in the console advising developers to use service workers instead (bug 1204581.) service workers should finally fix these issues.

SharedWorkerGlobalScope.applicationCache - Web APIs
important: application cache is deprecated as of firefox 44, and is no longer available in insecure contexts from firefox 60 onwards (bug 1354175, currently nightly/beta only).

SubtleCrypto.encrypt() - Web APIs
rsa-oaep the rsa-oaep public-key encryption system is specified in rfc 3447.

TextDecoder() - Web APIs
2:1987", "l2", "latin2" 'iso-8859-2' "csisolatin3", "iso-8859-3", "iso-ir-109", "iso8859-3", "iso88593", "iso_8859-3", "iso_8859-3:1988", "l3", "latin3" 'iso-8859-3' "csisolatin4", "iso-8859-4", "iso-ir-110", "iso8859-4", "iso88594", "iso_8859-4", "iso_8859-4:1988", "l4", "latin4" 'iso-8859-4' "csisolatincyrillic", "cyrillic", "iso-8859-5", "iso-ir-144", "iso88595", "iso_8859-5", "iso_8859-5:1988" 'iso-8859-5' "arabic", "asmo-708", "csiso88596e", "csiso88596i", "csisolatinarabic", "ecma-114", "iso-8859-6", "iso-8859-6-e", "iso-8859-6-i", "iso-ir-127", "iso8859-6", "iso88596", "iso_8859-6", "iso_8859-6:1987" 'iso-8859-6' "csisolatingreek", "ecma-118", "elot_928", "greek", "greek8", "iso-8859-7", "iso-ir-126", "iso...

TextDecoder - Web APIs
let win1251decoder = new textdecoder('windows-1251'); let bytes = new uint8array([207, 240, 232, 226, 229, 242, 44, 32, 236, 232, 240, 33]); console.log(win1251decoder.decode(bytes)); // Привет, мир!

URL.host - Web APIs
examples let url = new url('/docs/web/api/url/host'); console.log(url.host); // "developer.mozilla.org" url = new url('https://developer.mozilla.org:443/docs/web/api/url/host'); console.log(url.host); // "developer.mozilla.org" // the port number is not included because 443 is the scheme's default port url = new url('https://developer.mozilla.org:4097/docs/web/api/url/host'); console.log(url.host); // "developer.mozilla.org:4097" specifications specification status comment urlthe definition of 'url.host' in that speci...

URLSearchParams.set() - Web APIs
line #44: tries to automatically open a new window/tab with the generated url (when uncommented).

WEBGL_compressed_texture_astc - Web APIs
constants blocks bits per pixel arraybuffer bytelength bytes if height and width are 512 ext.compressed_rgba_astc_4x4_khr ext.compressed_srgb8_alpha8_astc_4x4_khr 4x4 8.00 floor((width + 3) / 4) * floor((height + 3) / 4) * 16 262144 ext.compressed_rgba_astc_5x4_khr ext.compressed_srgb8_alpha8_astc_5x4_khr 5x4 6.40 floor((width + 4) / 5) * floor((height + 3) / 4) * 16 210944 ext.compressed_rgba_astc_5x5_khr ext.compressed_srgb8_alpha8_astc_5x5_khr 5x5 5.12 floor((width + 4) / 5) * floor((height + 4) / 5) * 16 169744 ext.compressed_rgba_astc_6x5_khr ext.compresse...

WaveShaperNode.curve - Web APIs
amount : 50, n_samples = 44100, curve = new float32array(n_samples), deg = math.pi / 180, i = 0, x; for ( ; i < n_samples; ++i ) { x = i * 2 / n_samples - 1; curve[i] = ( 3 + k ) * x * 20 * deg / ( math.pi + k * math.abs(x) ); } return curve; }; ...

WaveShaperNode.oversample - Web APIs
amount : 50, n_samples = 44100, curve = new float32array(n_samples), deg = math.pi / 180, i = 0, x; for ( ; i < n_samples; ++i ) { x = i * 2 / n_samples - 1; curve[i] = ( 3 + k ) * x * 20 * deg / ( math.pi + k * math.abs(x) ); } return curve; }; ...

WaveShaperNode - Web APIs
amount : 50, n_samples = 44100, curve = new float32array(n_samples), deg = math.pi / 180, i = 0, x; for ( ; i < n_samples; ++i ) { x = i * 2 / n_samples - 1; curve[i] = ( 3 + k ) * x * 20 * deg / ( math.pi + k * math.abs(x) ); } return curve; }; ...

WebGL2RenderingContext.texImage3D() - Web APIs
gl.r8 gl.r16f gl.r32f gl.r8ui gl.rg8 gl.rg16f gl.rg32f gl.rgui gl.rgb8 gl.srgb8 gl.rgb565 gl.r11f_g11f_b10f gl.rgb9_e5 gl.rgb16f gl.rgb32f gl.rgb8ui gl.rgba8 gl.srgb_aplha8 gl.rgb5_a1 gl.rgba4444 gl.rgba16f gl.rgba32f gl.rgba8ui width a glsizei specifying the width of the texture.

WebGL2RenderingContext.texStorage3D() - Web APIs
possible values: gl.r8 gl.r16f gl.r32f gl.r8ui gl.rg8 gl.rg16f gl.rg32f gl.rgui gl.rgb8 gl.srgb8 gl.rgb565 gl.r11f_g11f_b10f gl.rgb9_e5 gl.rgb16f gl.rgb32f gl.rgb8ui gl.rgba8 gl.srgb_aplha8 gl.rgb5_a1 gl.rgba4444 gl.rgba16f gl.rgba32f gl.rgba8ui gl.compressed_r11_eac gl.compressed_signed_r11_eac gl.compressed_rg11_eac gl.compressed_signed_rg11_eac gl.compressed_rgb8_etc2 gl.compressed_rgba8_etc2_eac gl.compressed_srgb8_etc2 gl.compressed_srgb8_alpha8_etc2_eac gl.compressed_rgb8_punchthrough_alpha1_etc2 gl.compressed_srgb8_punchthrough_alpha1_etc2 width a glsizei specifyin...

WebGL2RenderingContext.texSubImage3D() - Web APIs
gl.r8 gl.r16f gl.r32f gl.r8ui gl.rg8 gl.rg16f gl.rg32f gl.rgui gl.rgb8 gl.srgb8 gl.rgb565 gl.r11f_g11f_b10f gl.rgb9_e5 gl.rgb16f gl.rgb32f gl.rgb8ui gl.rgba8 gl.srgb_aplha8 gl.rgb5_a1 gl.rgba4444 gl.rgba16f gl.rgba32f gl.rgba8ui type a glenum specifying the data type of the texel data.

Signaling and video calling - Web APIs
optionally, see rfc 8445: interactive connectivity establishment, section 2.3 ("negotiating candidate pairs and concluding ice") if you want greater understanding of how this process is completed inside the ice layer.

Writing WebSocket servers - Web APIs
warning: the server may listen on any port it chooses, but if it chooses any port other than 80 or 443, it may have problems with firewalls and/or proxies.

Fundamentals of WebXR - Web APIs
for example, if a headset uses a 2560x1440 screen, with the left half being used for the left eye's view and the right half or the right eye's view, the framebuffer is used like this: the simplest headsets have no integrated sensors, and simply focus each half of the screen into the corresponding eye.

Movement, orientation, and motion: A WebXR example - Web APIs
matrix'), modelviewmatrix: gl.getuniformlocation(shaderprogram, 'umodelviewmatrix'), normalmatrix: gl.getuniformlocation(shaderprogram, 'unormalmatrix'), usampler: gl.getuniformlocation(shaderprogram, 'usampler') }, }; buffers = initbuffers(gl); texture = loadtexture(gl, 'https://cdn.glitch.com/a9381af1-18a9-495e-ad01-afddfd15d000%2ffirefox-logo-solid.png?v=1575659351244'); xrsession.updaterenderstate({ baselayer: new xrwebgllayer(xrsession, gl) }); if (session_type == "immersive-vr") { refspacetype = "local"; } else { refspacetype = "viewer"; } mat4.fromtranslation(cubematrix, viewerstartposition); vec3.copy(cubeorientation, viewerstartorientation); xrsession.requestreferencespace(refspacetype) .then((refspace) => { xrrefer...

Controlling multiple parameters with ConstantSourceNode - Web APIs
iv class="right"> <span>volume: </span> <input type="range" min="0.0" max="1.0" step="0.01" value="0.8" name="volume" id="volumecontrol"> </div> </div> <p>use the button above to start and stop the tones, and the volume control to change the volume of the notes e and g in the chord.</p> css .controls { width: 400px; position: relative; vertical-align: middle; height: 44px; } .button { font-size: 32px; cursor: pointer; user-select: none; -moz-user-select: none; -webkit-user-select: none; -ms-user-select: none; -o-user-select: none; } .right { width: 50%; font: 14px "open sans", "lucida grande", "arial", sans-serif; position: absolute; right: 0; display: table-cell; vertical-align: middle; } .right span { vertical-align: middle; } .

Using IIR filters - Web APIs
something like this is acceptable: let feedforward = [0.00020298, 0.0004059599, 0.00020298]; our feedback values cannot start with zero, otherwise on the first pass nothing would be sent back: let feedbackward = [1.0126964558, -1.9991880801, 0.9873035442]; note: these values are calculated based on the lowpass filter specified in the filter characteristics of the web audio api specification.

Using the Web Speech API - Web APIs
browser support support for web speech api speech synthesis is still getting there across mainstream browsers, and is currently limited to the following: firefox desktop and mobile support it in gecko 42+ (windows)/44+, without prefixes, and it can be turned on by flipping the media.webspeech.synth.enabled flag to true in about:config.

Functions and classes available to Web Workers - Web APIs
44 (44) behind a feature preference setting.

Window.applicationCache - Web APIs
important: application cache is deprecated as of firefox 44, and is no longer available in insecure contexts from firefox 60 onwards (bug 1354175, currently nightly/beta only).

window.postMessage() - Web APIs
examples of typical origins are https://example.org (implying port 443), http://example.net (implying port 80), and http://example.com:8080.

WorkerGlobalScope.location - Web APIs
note: firefox has a bug with using console.log inside shared/service workers (see bug 1058644), which may return strange results, but this should be fixed soon.

WorkerGlobalScope.performance - Web APIs
note: firefox has a bug with using console.log inside shared/service workers (see bug 1058644), which may return strange results, but this should be fixed soon.

XMLDocument - Web APIs
mono,monospace" fill="#4d4e53" text-anchor="middle" alignment-baseline="middle">document</text></a><polyline points="346,25 356,20 356,30 346,25" stroke="#d4dde4" fill="none"/><line x1="356" y1="25" x2="386" y2="25" stroke="#d4dde4"/><a xlink:href="/docs/web/api/xmldocument" target="_top"><rect x="386" y="1" width="110" height="50" fill="#f4f7f8" stroke="#d4dde4" stroke-width="2px" /><text x="441" y="30" font-size="12px" font-family="consolas,monaco,andale mono,monospace" fill="#4d4e53" text-anchor="middle" alignment-baseline="middle">xmldocument</text></a></svg></div> a:hover text { fill: #0095dd; pointer-events: all;} property also inherits properties from: document xmldocument.async used with xmldocument.load() to indicate an asynchronous request.

Sending and Receiving Binary Data - Web APIs
var stream = components.classes["@mozilla.org/network/file-input-stream;1"] .createinstance(components.interfaces.nsifileinputstream); stream.init(file, 0x04 | 0x08, 0644, 0x04); // file is an nsifile instance // try to determine the mime type of the file var mimetype = "text\/plain"; try { var mimeservice = components.classes["@mozilla.org/mime;1"] .getservice(components.interfaces.nsimimeservice); mimetype = mimeservice.gettypefromfile(file); // file is an nsifile instance } catch (oevent) { /* eat it; just use text/plain */ } // send var req = c...

XMLHttpRequest - Web APIs
="_top"><rect x="151" y="1" width="250" height="50" fill="#fff" stroke="#d4dde4" stroke-width="2px" /><text x="276" y="30" font-size="12px" font-family="consolas,monaco,andale mono,monospace" fill="#4d4e53" text-anchor="middle" alignment-baseline="middle">xmlhttprequesteventtarget</text></a><polyline points="401,25 411,20 411,30 401,25" stroke="#d4dde4" fill="none"/><line x1="411" y1="25" x2="441" y2="25" stroke="#d4dde4"/><a xlink:href="/docs/web/api/xmlhttprequest" target="_top"><rect x="441" y="1" width="140" height="50" fill="#f4f7f8" stroke="#d4dde4" stroke-width="2px" /><text x="511" y="30" font-size="12px" font-family="consolas,monaco,andale mono,monospace" fill="#4d4e53" text-anchor="middle" alignment-baseline="middle">xmlhttprequest</text></a></svg></div> a:hover text { fil...

Accessibility documentation index - Accessibility
44 aria: list role aria, aria role, aria list, accessibility, reference, rôle, list the aria list role can be used to identify a list of items.

Operable - Accessibility
understanding motion actuation 2.5.5 target size (aaa) added in 2.1 the size of an actionable item's touch target must be at least 44 css pixels in both width and height.

::-webkit-meter-even-less-good-value - CSS: Cascading Style Sheets
examples html <meter min="0" max="10" value="6">score out of 10</meter> css meter::-webkit-meter-even-less-good-value { background: linear-gradient(to bottom, #f77, #d44 45%, #d44 55%, #f77); height: 100%; box-sizing: border-box; } result ...

::backdrop - CSS: Cascading Style Sheets
video::backdrop { background-color: #448; } the resulting screen looks like this: note the dark grey-blue letterbox effect above and below where the backdrop is visible.

@counter-style - CSS: Cascading Style Sheets
@counter-style thumbs { system: cyclic; symbols: "\1f44d"; suffix: " "; } ul { list-style: thumbs; } the initial version of css defined a set of useful counter styles.

Border-image generator - CSS: Cascading Style Sheets
#general-controls .name { height: 20px; margin: 0 10px 0 0; line-height: 100%; text-align: right; float: left; } #general-controls .right { width: 200px; float: right; } #general-controls .ui-checkbox label { height: 10px; } #general-controls .separator { height: 40px; width: 1px; margin: -10px 15px; background-color: #eee; float: left; } /* * controls */ #controls { color: #444; margin: 10px 0 0 0; } #controls .category { height: 190px; min-width: 260px; margin: 10px; padding: 10px; border: 1px solid #ccc; border-radius: 3px; float: left; box-shadow: 0 0 3px 0 #bababa; transition: all 0.25s; -moz-box-sizing: border-box; -webkit-box-sizing: border-box; box-sizing: border-box; } @media (min-width: 880px) { #controls .category { width: 30%; margin-le...

Border-radius generator - CSS: Cascading Style Sheets
text-align: center; position: relative; top: 40%; } #radius-lock [data-topic="top-left"] { top: 10px; left: 10px; } #radius-lock [data-topic="top-right"] { top: 10px; right: 10px; } #radius-lock [data-topic="bottom-right"] { bottom: 10px; right: 10px; } #radius-lock [data-topic="bottom-left"] { bottom: 10px; left: 10px; } /** * controls */ #dimensions { width: 200px; color: #444; float:left; } #dimensions input { background: #555; color: #fff; border: none; border-radius: 3px; } #output { width: 500px; padding: 10px 0; margin: 10px 0; color: #555; text-align: center; border: 1px dashed #999; border-radius: 3px; -moz-user-select: text; -webkit-user-select: text; -ms-user-select: text; user-select: text; float: right; } javascript content 'use str...

Box-shadow generator - CSS: Cascading Style Sheets
controls */ .wrap-left { float: left; overflow: hidden; } .wrap-right { float: right; overflow: hidden; } .wrap-left > * { float: left; } .wrap-right > * { float: right; } @media (min-width: 960px) { .wrap-left { width: 45%; } .wrap-right { width: 55%; } } @media (max-width: 959px) { .wrap-left { width: 30%; } .wrap-right { width: 70%; } } #controls { color: #444; margin: 10px 0 0 0; } #controls .category { width: 500px; margin: 0 auto 20px; padding: 0; } #controls .category .title { width: 100%; height: 1.5em; line-height: 1.5em; color: #aaa; text-align: right; } #controls .category > .group { border: 1px solid #ccc; border-radius: 3px; } /** * color picker */ @media (min-width: 960px) { #controls .colorpicker { width: 420px; }...

background-position - CSS: Cascading Style Sheets
1.5legend full support full support quantum css notes gecko has a bug meaning that background-position can't be transitioned between two values containing different numbers of <position> values, for example background-position: 10px 10px; and background-position: 20px 20px, 30px 30px; (see bug 1390446).

background-repeat - CSS: Cascading Style Sheets
} .four { background-repeat: repeat-y; } .five { background-repeat: space; } .six { background-repeat: round; } /* multiple images */ .seven { background-image: url(https://mdn.mozillademos.org/files/12005/starsolid.gif), url(https://developer.cdn.mozilla.net/media/redesign/img/favicon32.png); background-repeat: repeat-x, repeat-y; height: 144px; } result in this example, each list item is matched with a different value of background-repeat.

font-size-adjust - CSS: Cascading Style Sheets
d from version 79: this feature is behind the enable experimental web platform features preference.firefox full support 40 full support 40 full support 3notes notes before firefox 40, font-size-adjust: 0 was incorrectly interpreted as font-size-adjust: none (bug 1144885).

font-style - CSS: Cascading Style Sheets
be wonderful to meet a megalosaurus, forty feet long or so, waddling like an elephantine lizard up holborn hill.</p> </div> css /* amstelvaralpha-vf is created by david berlow (https://github.com/typenetwork/amstelvar) and is used here under the terms of its license: https://github.com/typenetwork/amstelvar/blob/master/ofl.txt */ @font-face { src: url('https://mdn.mozillademos.org/files/16044/amstelvaralpha-vf.ttf'); font-family:'amstelvaralpha'; font-style: normal; } label { font: 1rem monospace; } .container { max-height: 150px; overflow: scroll; } .sample { font: 2rem 'amstelvaralpha', sans-serif; } html, body { max-height: 100vh; max-width: 100vw; overflow: hidden; } body { display: flex; flex-direction: column; } header { margin-bottom: 1.5rem; } ...

<gradient> - CSS: Cascading Style Sheets
<div class="radial-gradient">radial gradient</div> div { width: 240px; height: 80px; } .radial-gradient { background: radial-gradient(red, yellow, rgb(30, 144, 255)); } repeating gradient examples simple repeating linear and radial gradient examples.

scrollbar-width - CSS: Cascading Style Sheets
and introduced in wcag 2.1, criterion 2.5.5 (target size) advises that touch targets should be at least 44px in width and height (although the problem is compounded on high-resolution screens; thorough testing is advised).

Setting up adaptive streaming media sources - Developer guides
andwidth="270370"> <segmentbase> <initialization sourceurl="main/news300/1.m4s" range="0-865"/> </segmentbase> <segmentlist duration="1"> <segmenturl media="main/news300/2.m4s" mediarange="866-26970"/> <segmenturl media="main/news300/3.m4s" mediarange="26971-72543"/> <segmenturl media="main/news300/4.m4s" mediarange="72544-95972"/> </segmentlist> </representation> ...

Making content editable - Developer guides
see bug 1449564 and firefox-specific html editing ui has been deprecated for additional details.

Applying color to HTML elements using CSS - HTML: Hypertext Markup Language
to make it 25% opaque, you can use "#0000ff44" or "#00f4".

HTML attribute: rel - HTML: Hypertext Markup Language
non-standard values apple-touch-icon-precomposed <!-- third-generation ipad with high-resolution retina display: --> <link rel="apple-touch-icon-precomposed" sizes="144x144" href="favicon144.png"> <!-- iphone with high-resolution retina display: --> <link rel="apple-touch-icon-precomposed" sizes="114x114" href="favicon114.png"> <!-- first- and second-generation ipad: --> <link rel="apple-touch-icon-precomposed" sizes="72x72" href="favicon72.png"> <!-- non-retina iphone, ipod touch, and android 2.1+ devices: --> <link rel="apple-touch-icon-precompo...

Date and time formats used in HTML - HTML: Hypertext Markup Language
examples of valid time strings time string time 00:00:30.75 12:00:30.75 am (30.75 seconds after midnight) 12:15 12:15 pm 13:44:25 1:44:25 pm (25 seconds after 1:44 pm) local date and time strings a valid datetime-local string consists of a date string and a time string concatenated together with either the letter "t" or a space character separating them.

<a>: The Anchor element - HTML: Hypertext Markup Language
a minimum size of 44×44 css pixels is recommended.

<button>: The Button element - HTML: Hypertext Markup Language
a minimum interactive size of 44×44 css pixels is recommended.

<div>: The Content Division element - HTML: Hypertext Markup Language
html <div class="shadowbox"> <p>here's a very interesting note displayed in a lovely shadowed box.</p> </div> css .shadowbox { width: 15em; border: 1px solid #333; box-shadow: 8px 8px 5px #444; padding: 8px 12px; background-image: linear-gradient(180deg, #fff, #ddd 40%, #ccc); } result specifications specification status comment html living standardthe definition of '<div>' in that specification.

<input>: The Input (Form Input) element - HTML: Hypertext Markup Language
a minimum interactive size of 44×44 css pixels is recommended.

<link>: The External Resource Link element - HTML: Hypertext Markup Language
<!-- third-generation ipad with high-resolution retina display: --> <link rel="apple-touch-icon-precomposed" sizes="144x144" href="favicon144.png"> <!-- iphone with high-resolution retina display: --> <link rel="apple-touch-icon-precomposed" sizes="114x114" href="favicon114.png"> <!-- first- and second-generation ipad: --> <link rel="apple-touch-icon-precomposed" sizes="72x72" href="favicon72.png"> <!-- non-retina iphone, ipod touch, and android 2.1+ devices: --> <link rel="apple-touch-icon-precomposed" href="favi...

<menuitem> - HTML: Hypertext Markup Language
example html content <!-- a <div> element with a context menu --> <div contextmenu="popup-menu"> right-click to see the adjusted context menu </div> <menu type="context" id="popup-menu"> <menuitem type="checkbox" checked>checkbox</menuitem> <hr> <menuitem type="command" label="this command does nothing" icon="https://developer.cdn.mozilla.net/static/img/favicon144.png"> commands don't render their contents.

<tr>: The Table Row element - HTML: Hypertext Markup Language
tbody > tr > th:first-of-type { text-align: left; background-color: rgb(225, 229, 244); } this styles the first header cell in each row of the table's body with text-align to left-justify the member names, and with a somewhat different background color.

Link types - HTML: Hypertext Markup Language
starting with firefox 44, the value of the crossorigin attribute is taken into consideration, making it possible to make anonymous prefetches.

Using the application cache - HTML: Hypertext Markup Language
as of firefox 44+, when appcache is used to provide offline support for a page, a warning message displays in the console advising developers to use service workers instead (bug 1204581).

Configuring servers for Ogg media - HTTP
ogg overhead presentation-time: 0.000 basetime: 0.000 theora: serialno 0170995062 1790 packets in 1068 pages, 1.7 packets/page, 1.049% ogg overhead video-framerate: 29.983 fps video-width: 640 video-height: 360 vorbis: serialno 0708996688 4531 packets in 167 pages, 27.1 packets/page, 1.408% ogg overhead audio-samplerate: 44100 hz audio-channels: 2 note that you can't simply serve up the reported content-duration line reported by oggz-info, because it's reported in hh:mm:ss format.

Alt-Svc - HTTP
example alt-svc: h2=":443"; ma=2592000; alt-svc: h2=":443"; ma=2592000; persist=1 alt-svc: h2="alt.example.com:443", h2=":443" alt-svc: h3-25=":443"; ma=3600, h2=":443"; ma=3600 specifications specification status comment rfc 7838 ietf rfc initial definition.

CSP: base-uri - HTTP
mail.example.com:443: matches all attempts to access port 443 on mail.example.com.

CSP: child-src - HTTP
mail.example.com:443: matches all attempts to access port 443 on mail.example.com.

CSP: connect-src - HTTP
mail.example.com:443: matches all attempts to access port 443 on mail.example.com.

CSP: default-src - HTTP
mail.example.com:443: matches all attempts to access port 443 on mail.example.com.

CSP: font-src - HTTP
mail.example.com:443: matches all attempts to access port 443 on mail.example.com.

CSP: form-action - HTTP
mail.example.com:443: matches all attempts to access port 443 on mail.example.com.

CSP: frame-ancestors - HTTP
mail.example.com:443: matches all attempts to access port 443 on mail.example.com.

CSP: frame-src - HTTP
mail.example.com:443: matches all attempts to access port 443 on mail.example.com.

CSP: img-src - HTTP
mail.example.com:443: matches all attempts to access port 443 on mail.example.com.

CSP: manifest-src - HTTP
mail.example.com:443: matches all attempts to access port 443 on mail.example.com.

CSP: media-src - HTTP
mail.example.com:443: matches all attempts to access port 443 on mail.example.com.

CSP: navigate-to - HTTP
mail.example.com:443: matches all attempts to access port 443 on mail.example.com.

CSP: object-src - HTTP
mail.example.com:443: matches all attempts to access port 443 on mail.example.com.

CSP: prefetch-src - HTTP
mail.example.com:443: matches all attempts to access port 443 on mail.example.com.

CSP: script-src-attr - HTTP
mail.example.com:443: matches all attempts to access port 443 on mail.example.com.

CSP: script-src-elem - HTTP
mail.example.com:443: matches all attempts to access port 443 on mail.example.com.

CSP: script-src - HTTP
mail.example.com:443: matches all attempts to access port 443 on mail.example.com.

CSP: style-src-attr - HTTP
mail.example.com:443: matches all attempts to access port 443 on mail.example.com.

CSP: style-src-elem - HTTP
mail.example.com:443: matches all attempts to access port 443 on mail.example.com.

CSP: style-src - HTTP
mail.example.com:443: matches all attempts to access port 443 on mail.example.com.

CSP: worker-src - HTTP
mail.example.com:443: matches all attempts to access port 443 on mail.example.com.

Host - HTTP
if no port is included, the default port for the service requested (e.g., 443 for an https url, and 80 for an http url) is implied.

Index - HTTP
44 csp: report-uri csp, directive, http, reference, security the deprecated http content-security-policy (csp) report-uri directive instructs the user agent to report attempts to violate the content security policy.

CONNECT - HTTP
request has body no successful response has body yes safe no idempotent no cacheable no allowed in html forms no syntax connect www.example.com:443 http/1.1 example some proxy servers might need authority to create a tunnel.

An overview of HTTP - HTTP
for example: get / http/1.1 host: developer.mozilla.org accept-language: fr read the response sent by the server, such as: http/1.1 200 ok date: sat, 09 oct 2010 14:28:02 gmt server: apache last-modified: tue, 01 dec 2009 20:18:22 gmt etag: "51142bc1-7449-479b075b2891b" accept-ranges: bytes content-length: 29769 content-type: text/html <!doctype html...

HTTP Public Key Pinning (HPKP) - HTTP
openssl s_client -servername www.example.com -connect www.example.com:443 | openssl x509 -pubkey -noout | openssl pkey -pubin -outform der | openssl dgst -sha256 -binary | openssl enc -base64 example hpkp header public-key-pins: pin-sha256="cupctazwkaasuywhhnedttwpy3obake3h2+sozs7sws="; pin-sha256="m8hztczm3eluxkcjr2s5p4hhybnf6lhkmjahkhpgpwe="; max-age=5184000; includesubdomains; report-uri="https://www.example.org/hpkp-report" in this example, pin-sha256="...

Redirections in HTTP - HTTP
the mod_alias module has redirect and redirectmatch directives that set up 302 redirects by default: <virtualhost *:443> servername example.com redirect / https://www.example.com </virtualhost> the url https://example.com/ will be redirected to https://www.example.com/, as will any files or directories under it (https://example.com/some-page will be redirected to https://www.example.com/some-page) redirectmatch does the same, but takes a regular expression to define a collection of affected urls: redirectma...

HTTP resources and specifications - HTTP
proposed standard rfc 8446 the transport layer security (tls) protocol version 1.3 supersedes tls 1.2.

Text formatting - JavaScript
const july172014 = new date(msperday * (44 * 365 + 11 + 197)); const options = { year: '2-digit', month: '2-digit', day: '2-digit', hour: '2-digit', minute: '2-digit', timezonename: 'short' }; const americandatetime = new intl.datetimeformat('en-us', options).format; console.log(americandatetime(july172014)); // 07/16/14, 5:00 pm pdt number formatting the numberformat object is useful for formatting numbers, for examp...

Warning: 08/09 is not a legal ECMA-262 octal constant - JavaScript
examples invalid octal numbers 08; 09; // syntaxerror: 08 is not a legal ecma-262 octal constant // syntaxerror: "0"-prefixed octal literals and octal escape sequences // are deprecated valid octal numbers use a leading zero followed by the letter "o"; 0o755; 0o644; ...

SyntaxError: "x" is a reserved identifier - JavaScript
firefox 44 and older) ...

Array.prototype.filter() - JavaScript
function isbigenough(value) { return value >= 10 } let filtered = [12, 5, 8, 130, 44].filter(isbigenough) // filtered is [12, 130, 44] find all prime numbers in an array the following example returns all prime numbers in the array: const array = [-3, -2, -1, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13]; function isprime(num) { for (let i = 2; num > i; i++) { if (num % i == 0) { return false; } } return num > 1; } console.log(array.filter(isprime)); // [...

BigInt.asUintN() - JavaScript
const max = 2n ** 64n - 1n; bigint.asuintn(64, max); // ↪ 18446744073709551615n bigint.asuintn(64, max + 1n); // ↪ 0n // zero because of overflow specifications specification ecmascript (ecma-262)the definition of 'bigint.asuintn()' in that specification.

DataView.prototype.setBigUint64() - JavaScript
the highest possible value that fits in an unsigned 64-bit integer is 2n ** 64n - 1n (18446744073709551615n).

Date.prototype.getTime() - JavaScript
// reduced time precision with `privacy.resistfingerprinting` enabled new date().gettime(); // 1519129853500 // 1519129858900 // 1519129864400 // ...

Date.now() - JavaScript
// reduced time precision with `privacy.resistfingerprinting` enabled date.now(); // 1519129853500 // 1519129858900 // 1519129864400 // ...

Math.LOG10E - JavaScript
examples using math.log10e the following function returns the base 10 logarithm of e: function getlog10e() { return math.log10e; } getlog10e(); // 0.4342944819032518 specifications specification ecmascript (ecma-262)the definition of 'math.log10e' in that specification.

Math.atan() - JavaScript
examples using math.atan() math.atan(1); // 0.7853981633974483 math.atan(0); // 0 math.atan(-0); // -0 math.atan(infinity); // 1.5707963267948966 math.atan(-infinity); // -1.5707963267948966 // the angle that the line [(0,0);(x,y)] forms with the x-axis in a cartesian coordinate system math.atan(y / x); note that you may want to avoid using ±infinity for stylistic reasons.

Math.atanh() - JavaScript
<1\left|x\right| < 1, we have artanh(x)=12ln(1+x1-x)\operatorname {artanh} (x) = \frac{1}{2}\ln \left( \frac{1 + x}{1 - x} \right) so this can be emulated by the following function: math.atanh = math.atanh || function(x) { return math.log((1+x)/(1-x)) / 2; }; examples using math.atanh() math.atanh(-2); // nan math.atanh(-1); // -infinity math.atanh(0); // 0 math.atanh(0.5); // 0.5493061443340548 math.atanh(1); // infinity math.atanh(2); // nan for values greater than 1 or less than -1, nan is returned.

Math.exp() - JavaScript
examples using math.exp() math.exp(-1); // 0.36787944117144233 math.exp(0); // 1 math.exp(1); // 2.718281828459045 specifications specification ecmascript (ecma-262)the definition of 'math.exp' in that specification.

Math - JavaScript
math.log2e base-2 logarithm of e; approximately 1.443.

Number.EPSILON - JavaScript
property attributes of number.epsilon writable no enumerable no configurable no description the epsilon property has a value of approximately 2.2204460492503130808472633361816e-16, or 2-52.

Number - JavaScript
using number to convert a date object the following example converts the date object to a numerical value using number as a function: let d = new date('december 17, 1995 03:24:00') console.log(number(d)) this logs 819199440000.

Promise.race() - JavaScript
examples asynchronicity of promise.race this following example demonstrates the asynchronicity of promise.race: // we are passing as argument an array of promises that are already resolved, // to trigger promise.race as soon as possible var resolvedpromisesarray = [promise.resolve(33), promise.resolve(44)]; var p = promise.race(resolvedpromisesarray); // immediately logging the value of p console.log(p); // using settimeout we can execute code after the stack is empty settimeout(function(){ console.log('the stack is now empty'); console.log(p); }); // logs, in order: // promise { <state>: "pending" } // the stack is now empty // promise { <state>: "fulfilled", <value>: 33 } an empty i...

String.prototype.normalize() - JavaScript
it is compatible with the u+0044 code point ("d").

WebAssembly.CompileError() constructor - JavaScript
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...

WebAssembly.Instance() constructor - JavaScript
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...

WebAssembly.Instance.prototype.exports - JavaScript
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...

WebAssembly.LinkError() constructor - JavaScript
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...

WebAssembly.Memory() constructor - JavaScript
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...

WebAssembly.Memory.prototype.buffer - JavaScript
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...

WebAssembly.Memory.prototype.grow() - JavaScript
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...

WebAssembly.Module() constructor - JavaScript
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...

WebAssembly.Module.customSections() - JavaScript
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...

WebAssembly.Module.exports() - JavaScript
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...

WebAssembly.Module.imports() - JavaScript
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...

WebAssembly.RuntimeError() constructor - JavaScript
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...

WebAssembly.Table() constructor - JavaScript
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...

WebAssembly.Table.prototype.get() - JavaScript
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...

WebAssembly.Table.prototype.grow() - JavaScript
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...

WebAssembly.Table.prototype.length - JavaScript
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...

WebAssembly.Table.prototype.set() - JavaScript
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...

WebAssembly.compile() - JavaScript
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...

WebAssembly.instantiate() - JavaScript
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...

WebAssembly.validate() - JavaScript
57edge full support 16firefox full support 52notes full support 52notes notes disabled in the firefox 52 extended support release (esr).ie no support noopera full support 44safari full support 11webview android full support 57chrome android full support 57firefox android full support 52notes full support 52notes notes disabled in the firefox 52 ...

Lexical grammar - JavaScript
var n = 0o755; // 493 var m = 0o644; // 420 // also possible with just a leading zero (see note about decimals above) 0755 0644 hexadecimal hexadecimal number syntax uses a leading zero followed by a lowercase or uppercase latin letter "x" (0x or 0x).

delete operator - JavaScript
delete employeedetails; // returns true function f() { var z = 44; // delete doesn't affect local variable names delete z; // returns false } delete and the prototype chain in the following example, we delete an own property of an object while a property with the same name is available on the prototype chain: function foo() { this.bar = 10; } foo.prototype.bar = 42; var foo = new foo(); // foo.bar is associated with the // own property.

Strict mode - JavaScript
the octal syntax isn't part of ecmascript 5, but it's supported in all browsers by prefixing the octal number with a zero: 0644 === 420 and "\045" === "%".

Web app manifests
f", "description": "a simply readable hacker news app.", "icons": [{ "src": "images/touch/homescreen48.png", "sizes": "48x48", "type": "image/png" }, { "src": "images/touch/homescreen72.png", "sizes": "72x72", "type": "image/png" }, { "src": "images/touch/homescreen96.png", "sizes": "96x96", "type": "image/png" }, { "src": "images/touch/homescreen144.png", "sizes": "144x144", "type": "image/png" }, { "src": "images/touch/homescreen168.png", "sizes": "168x168", "type": "image/png" }, { "src": "images/touch/homescreen192.png", "sizes": "192x192", "type": "image/png" }], "related_applications": [{ "platform": "play", "url": "https://play.google.com/store/apps/details?id=cheeaun.hackerweb" }] } d...

MathML attribute reference - MathML
use u+2044 (fraction slash) instead.

<mfrac> - MathML
use u+2044 (fraction slash) instead.

azimuth - SVG: Scalable Vector Graphics
only one element is using this attribute: <fedistantlight> html, body, svg { height: 100%; } <svg viewbox="0 0 440 200" xmlns="http://www.w3.org/2000/svg"> <filter id="distantlight1"> <fediffuselighting> <fedistantlight azimuth="0" /> </fediffuselighting> </filter> <filter id="distantlight2"> <fediffuselighting> <fedistantlight azimuth="240" /> </fediffuselighting> </filter> <circle cx="100" cy="100" r="80" style="filter: url(#distantlight1);" /> <circle cx="100" cy="100" r="80" style="filter: url(#distantlight2); transform: translatex(240px);" /> </svg> usage notes value <number> default ...

elevation - SVG: Scalable Vector Graphics
only one element is using this attribute: <fedistantlight> html, body, svg { height: 100%; } <svg viewbox="0 0 440 200" xmlns="http://www.w3.org/2000/svg"> <filter id="distantlight1"> <fediffuselighting> <fedistantlight elevation="0" /> </fediffuselighting> </filter> <filter id="distantlight2"> <fediffuselighting> <fedistantlight elevation="45" /> </fediffuselighting> </filter> <circle cx="100" cy="100" r="80" style="filter: url(#distantlight1);" /> <circle cx="100" cy="100" r="80" style="filter: url(#distantlight2); transform: translatex(240px);" /...

xChannelSelector - SVG: Scalable Vector Graphics
only one element is using this attribute: <fedisplacementmap> html, body, svg { height: 100%; } <svg viewbox="0 0 440 160" xmlns="http://www.w3.org/2000/svg"> <filter id="displacementfilter"> <feimage xlink:href="https://mdn.mozillademos.org/files/12668/mdn.svg" x="0" y="0" width="100%" height="100%" result="abc"/> <fedisplacementmap in2="abc" in="sourcegraphic" scale="30" xchannelselector="r"/> </filter> <filter id="displacementfilter2"> <feimage xlink:href="https://mdn.mozillademos.org/files/12668/mdn.svg" x="0" y="0" width="100%" height="100%" result="abc"/> <fedisplacementmap in2="abc" in="sourcegraphic" ...

yChannelSelector - SVG: Scalable Vector Graphics
only one element is using this attribute: <fedisplacementmap> html, body, svg { height: 100%; } <svg viewbox="0 0 440 160" xmlns="http://www.w3.org/2000/svg"> <filter id="displacementfilter"> <feimage xlink:href="https://mdn.mozillademos.org/files/12668/mdn.svg" x="0" y="0" width="100%" height="100%" result="abc"/> <fedisplacementmap in2="abc" in="sourcegraphic" scale="30" ychannelselector="r"/> </filter> <filter id="displacementfilter2"> <feimage xlink:href="https://mdn.mozillademos.org/files/12668/mdn.svg" x="0" y="0" width="100%" height="100%" result="abc"/> <fedisplacementmap in2="abc" in="sourcegraphic" ...

<feDiffuseLighting> - SVG: Scalable Vector Graphics
<svg width="440" height="140" xmlns="http://www.w3.org/2000/svg"> <!-- no light is applied --> <text text-anchor="middle" x="60" y="22">no light</text> <circle cx="60" cy="80" r="50" fill="green" /> <!-- the light source is a fepointlight element --> <text text-anchor="middle" x="170" y="22">fepointlight</text> <filter id="lightme1"> <fediffuselighting in="sourcegraphic" result="light" ...

<metadata> - SVG: Scalable Vector Graphics
bol --> <symbol id="hubplug"> <desc>a 10baset/100basetx socket</desc> <path d="m0,10 h5 v-9 h12 v9 h5 v16 h-22 z"/> </symbol> <!-- hub symbol --> <symbol id="hub"> <desc>a typical 10baset/100basetx network hub</desc> <text x="0" y="15">hub</text> <g transform="translate(0 20)"> <rect width="253" height="84"/> <rect width="229" height="44" x="12" y="10"/> <circle fill="red" cx="227" cy="71" r="7" /> <!-- five groups each using the defined socket --> <g id="sock1et" transform="translate(25 20)"> <title>socket 1</title> <use xlink:href="#hubplug"/> </g> <g id="socket2" transform="translate(70 20)"> <title>socket 2</title> <use xlink:href="#hubplug"/> ...

SVG 2 support in Mozilla - SVG: Scalable Vector Graphics
status unknown shape-inside property inplementation status unknown shape-subtract property inplementation status unknown white-space implementation status unknown deprecated xml:space attribute implementation status unknown kerning property removed implementation status unknown path attribute for <textpath> implemented (bug 1446617) reference basic shapes to <textpath> implementation status unknown side attribute for <textpath> implemented (bug 1446650) render characters for one loop of a single closed path, effected by the startoffset attribute and text-anchor property implementation status unknown <tref> removed implementation status unknown <altglyph>, <altglyp...

Other content in SVG - SVG: Scalable Vector Graphics
this means, that you can use clips, masks, filters, rotations and all other tools of svg on the content: <svg version="1.1" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" width="200" height="200"> <image x="90" y="-65" width="128" height="146" transform="rotate(45)" xlink:href="https://developer.mozilla.org/static/img/favicon144.png"/> </svg> screenshotlive sample embedding arbitrary xml since svg is an xml application, you can of course always embed arbitrary xml anywhere in an svg document.

Paths - SVG: Scalable Vector Graphics
p://www.w3.org/2000/svg" width="320" height="320"> <path d="m 10 315 l 110 215 a 36 60 0 0 1 150.71 170.29 l 172.55 152.45 a 30 50 -45 0 1 215.1 109.9 l 315 10" stroke="black" fill="green" stroke-width="2" fill-opacity="0.5"/> <circle cx="150.71" cy="170.29" r="2" fill="red"/> <circle cx="110" cy="215" r="2" fill="red"/> <ellipse cx="144.931" cy="229.512" rx="36" ry="60" fill="transparent" stroke="blue"/> <ellipse cx="115.779" cy="155.778" rx="36" ry="60" fill="transparent" stroke="blue"/> </svg> notice that each of the blue ellipses are formed by two arcs, depending on travelling clockwise or counter-clockwise.

Index - XPath
44 starts-with xslt, xslt_reference the starts-with checks whether the first string starts with the second string and returns true or false.

Index - XSLT: Extensible Stylesheet Language Transformations
44 <xsl:processing-instruction> element, reference, xslt, processing-instruction the <xsl:processing-instruction> element writes a processing instruction to the output document.