Localizing with Koala
url: http://hg.mozilla.org/releases/mozilla-1.9.2.
...koala will now try to clone the en-us source repository from http://hg.mozilla.org/releases/mozilla-1.9.2.
...the easy way involves opening the console and issuing the following commands: c:\users\stas> cd c:\mozilla\l10n\application\firefox c:\mozilla\l10n\application\firefox> rmdir 3.6 c:\mozilla\l10n\application\firefox> hg clone http://hg.mozilla.org/releases/mozilla-1.9.2 3.6 requesting all changes adding changesets adding manifests adding file changes added 33099 changesets with 158636 changes to 50664 files (+9 heads) updating working directory 40357 files updated, 0 files merged, 0 files removed, 0 files unresolved configure the locale locale id: x-testing (put your locale's code) version: 3.6 location: choose the folder where you ...
...And 20 more matches

Bootstrapping a new locale
in mozilla, we use the the mercurial version control system (hg) to help manage our localizations.
... when a localization team is registered and your hg repository is set up for a locale, you can then clone the existing mozilla release branch (i.e.
... hg allows localizers to work locally on their machines and then "push" changes to their official mozilla repository.
...And 16 more matches

Release phase
your official release repository now that your locale has been registered, the localization files will live on mozilla mercurial server at hg.mozilla.org.
... depending on which branch you work on, the url of your repository might look like this: http://hg.mozilla.org/releases/l10n-central/x-testing if you followed the koala or plain text approach, you probably already have a local clone of the repository.
...configuration before you try pushing, you need to tell ssh which username you wish to use for connecting with hg.mozilla.org.
...And 15 more matches

QA phase
preliminary instructions we will be using the following file directories for this example: your working directory (root)/ mozilla-aurora (en-us source, pulled from http://hg.mozilla.org/releases/mozilla-aurora )/ l10n-central (directory for l10n directories, one per l10n; often referred to as "l10n base")/ your-locale-code (a directory with your l10n files, in this example we'll use x-testing) example: root/mozilla-aurora & root/l10n-central/x-testing additionally, you will need to copy and translate the toolkit/defines.inc file directly from en-us bef...
... to create and configure this file, follow these instructions: until the fix for bug 1063880 lands on mozilla-aurora and mozilla-beta when building language packs against those two trees you should: remove ac_add_options --disable-compile-environment from .mozconfig in step 3 use ./mach build config after step 4 update the mozilla source code: $ cd mozilla-aurora $ hg pull -u enter the following command to create the .mozconfig file: $ nano -w .mozconfig enter the following lines in your .mozconfig file: mk_add_options moz_objdir=@topsrcdir@/../firefox-build ac_add_options --disable-compile-environment ac_add_options --with-l10n-base=../l10n-central # path relative to moz_objdir ac_add_options --enable-application=[browser or mail] you will need to spe...
... the official localization teams use repositories at hg.mozilla.org.
...And 14 more matches

Application Translation with Mercurial
getting the current texts in english and your locale obtaining the english texts with the source code get the source code by downloading the following file: firefox desktop or firefox for android: download the mozilla-<branch>.hg file (e.g.
... mozilla-aurora.hg) from https://ftp.mozilla.org/pub/mozilla.org/firefox/bundles/ the file is not small, but after initially downloading it, you only need to download the latest changes in the future.
... thunderbird, lightning or seamonkey: download the comm-<branch>.hg file (e.g.
...And 12 more matches

Merging TraceMonkey Repo - Archive of obsolete content
hg clone ssh://hg.mozilla.org/mozilla-central mozilla-central hg clone ssh://hg.mozilla.org/tracemonkey tm-merge cd tm-merge pull mozilla-central into tracemonkey via hg pull ../mozilla-central you will see a notice about adding at least one head to the repository -- this is the mozilla-central head that you are about to merge.
... merge via hg merge you may see a number of conflicts.
... conflicting files can be listed via hg resolve -l.
...And 4 more matches

Simple Instantbird build
windows build prerequisites gnu/linux build prerequisites mac os x build prerequisites tip: after completing setup for your os, and before you get the source, you can opt to add the progressextension to your mercurial.ini (for windows) or .hgrc (for *nix / mac) file.
...see: configure mercurial .hgrc file for progress extension.
... get the latest source code from mozilla's comm-central mercurial code repository: hg clone http://hg.mozilla.org/comm-central then, get all the repositories it depends on.
...And 4 more matches

Uplifting a localization from Central to Aurora
let's pretend it's at releases/l10n-mozilla-aurora/ab-cd here's how we do it: # set up a new local clone of your central repo hg clone l10n-central/ab-cd workrepo cd workrepo # pull in the changesets you have on aurora hg pull -r default ../releases/l10n/mozilla-aurora/ab-cd now, there are two routes forward: 1) things are pretty silent.
...this looks something like searching for changes adding changesets adding manifests adding file changes added 22 changesets with 23 changes to 46 files (+1 heads) (run 'hg heads' to see heads, 'hg merge' to merge) ok, let's make sure we're not talking relbranches: hg heads --template '{node} {branches}\n' this is printing something like 5131e147fa50c28ec858c7d9fd1ba201ea2a433b 4da525ed77699794c56081791bd46cc85983f6f8 9bc7e6c58fc091c8cd0e8d9e1dbc7e6f592772a7 gecko20b12_2011022218_relbranch 230e99fada602842d9630e673077ef9f1ab34247 gecko20b12pre_20110216_relbranch 41a4357884d7bcc50e69c71014124d3af2482...
...hg merge if this just passes, you want to commit, and you probably want to use a commit message like "merging central and aurora".
...And 4 more matches

What every Mozilla translator should know
also a good idea to read the planet mozilla l10n when you have a problem use the above mailing lists the person in charge of the mozilla l10n is axel hecht (l10n at mozilla.com), pike on irc another interesting way of getting help is the irc channel #l10n at irc.mozilla.org useful tools the l10n dashboard pontoon narro translate toolkit koala 0.1 mozillatranslator mercurial the hg is organized into several repositories, sometimes called branches.
...when a development is started for an specific version, a new repository is created under hg.mozilla.org/releases/.
... some branch/release names identified: mozilla source + en-us localization files for [ab-cd] locale corresponding firefox version branches in hg mozilla-central l10n-central firefox.next (trunk) mozilla-1.9.2 l10n-mozilla-1.9.2 firefox 3.6 mozilla-1.9.1 l10n-mozilla-1.9.1 firefox 3.5 and, on the former revision control system, cvs: cvs trunk (the default branch) -> firefox/thunderbird 3.0.x branch mozilla_1_8_branch -> firefox/thunderbird 2.0 branch mozilla cross-reference mozilla ...
...And 4 more matches

How to Write and Land Nanojit Patches - Archive of obsolete content
repository: http://hg.mozilla.org/projects/nanojit-central (or clone ssh://hg.mozilla.org/projects/nanojit-central if you want to actually commit changes) tinderbox: http://tinderbox.mozilla.org/showbuilds.cgi?tree=nanojit commit log: http://hg.mozilla.org/projects/nanojit-central/shortlog/ irc channel: irc.mozilla.org #nanojit procedure the first thing to understand is that there are now three copies of nanojit in p...
... here's how to clone and build nanojit-central: $ hg clone ssh://hg.mozilla.org/projects/nanojit-central $ cd nanojit-central $ autoconf $ mkdir build $ cd build $ ../configure $ make $ make check learn and setup automated testing for all three repositories.
...(note that nanojit-central revision urls have the form http://hg.mozilla.org/projects/nanojit-central/<revid>, ie.
...And 3 more matches

Updating NSPR or NSS in mozilla-central
the nspr and nss sources in mozilla-central are maintained by the nspr and nss teams and always taken from exports of hg tags.
...if you check in an individual change by mistake, your change will be lost when the nspr and nss teams push a new hg tag to mozilla-central.
... (because some developers might not be aware that nspr/nss are separately maintained and released, the mozilla hg server rejects accidental changes/forking, if the required keywords are missing in the commit comment.) if nspr or nss must be upgraded to a new static tag, follow this procedure: before starting, make sure your local repository is updated to mozilla-central tip and that there are no local changes: $ hg status -mard pull the new sources $ python client.py update_nspr nspr_tag_name or $ python client.py update_nss nss_tag_name if you update a branch older than mozilla 17 (without the change from bug 782784), you must manually add a dummy change (add or remove a blank line) to force a rebuild of nspr: mozilla/nsprpub/config/prdepend.h or nss: mozilla/se...
...And 3 more matches

StringView - Archive of obsolete content
let's try to translate the "hello world!" string into the italian "ciao mondo!!"… var swhelloworld = stringview.makefrombase64("f0vmrgibaqaaaaaaaaaaaaiapgabaaaaearaaaaaaabaaaaaaaaaafakaaaaaaaaaaaaaeaaoaaiaeaahgabaayaaaafaaaaqaaaaaaaaabaaeaaaaaaaeaaqaaaaaaawaeaaaaaaadaaqaaaaaaaagaaaaaaaaaawaaaaqaaaaaagaaaaaaaaacqaaaaaaaaajaaaaaaaacaaaaaaaaabwaaaaaaaaaaqaaaaaaaaabaaaabqaaaaaaaaaaaaaaaabaaaaaaaaaaeaaaaaaanwgaaaaaaaa3ayaaaaaaaaaacaaaaaaaaeaaaagaaaa4ayaaaaaaadgbmaaaaaaaoagyaaaaaaamaiaaaaaaaa4agaaaaaaaaaaiaaaaaaaagaaaayaaad4bgaaaaaaapggyaaaaaaa+azgaaaaaadqaqaaaaaaanabaaaaaaaacaaaaaaaaaaeaaaabaaaabwcaaaaaaaaha...
...aaabaaaaabaaaar05vaaaaaaacaaaabgaaacaaaaaeaaaafaaaaamaaabhtluaksr2sawefp5pykgmju+b+9ybp2ubaaaaaqaaaaeaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaasaaaasaaaaaaaaaaaaaaaaaaaaaaaaabaaaaasaaaaaaaaaaaaaaaaaaaaaaaaaciaaaagaaaaaaaaaaaaaaaaaaaaaaaaaabsawjjlnnvljyachv0cwbfx2xpymnfc3rhcnrfbwfpbgbfx2dtb25fc3rhcnrfxwbhtelcq18yljiunqaaaaacaaiaaaaaaaeaaqabaaaaeaaaaaaaaab1gmkjaaacadeaaaaaaaaayahgaaaaaaagaaaaawaaaaaaaaaaaaaa6ahgaaaaaaahaaaaaqaaaaaaaaaaaaaa8ahgaaaaaaahaaaaagaaaaaaaaaaaaaa+ahgaaaaaaahaaaaawaaaaaaaaaaaaaasipsceilbrufiabihcb0behdaaaasipecmmaaaaaaaaaaaaaaaaaap81agugap8lbaugaa8fqad/jqifiaboaaaaaong/////yx6bcaaaaeaaadp0p////8l8gqgaggcaaaa6cd///8x7umj0v5iiejig+twufrjx8cqbuaasmfbiavaaejhxwafqadot/////rmka8fqac4fwlgafvilrajyabig/gosinldwjdw7gaaaaasixadprdvxajyad/4a8fgaaaaac4ealgafvi...
...u0wp5thbsmh9a0id7ajovf7//0if7xqedx+eaaaaaabmiepmifzeif9b/xtcsipdaug563xqsipecftdqvxbxufeqv/dzmyudx+eaaaaaadzw2aqsipsceidxajdaaaaaqacaehlbgxvihdvcmxkiqaaaaabgwm7maaaaauaaaac/v//faaaafz+//9maaaatp///6qaaabs////xaaaanz///8maqaafaaaaaaaaaabeliaaxgqarsmbwiqaqcqfaaaabwaaaai/v//kgaaaaaaaaaaaaaafaaaaaaaaaabeliaaxgqarsmbwiqaqaajaaaabwaaacy/f//qaaaaaaoeeyogeopc3cigaa/gjsqmyqiaaaaabwaaabeaaaaop7//xuaaaaaqq4qhgjddqzqdaciaaaaraaaagqaaacg/v//zqaaaabcdhcpakuogi4drq4gjqrfdiimbugomiygsa44gwdndkbsdjhbdjbbdihcdibcdhhcdhbcdggafaaaakwaaadi/v//agaaaaaaaaaaaaaaaaaaaaaaaadqbeaaaaaaalaeqaaaaaaaaaaaaaaaaaabaaaaaaaaaaeaaaaaaaaadaaaaaaaaacoa0aaaaaaaa0aaaaaaaaalavaaaaaaaazaaaaaaaaaoagyaaaaaaagwaaaaaaaaaiaaaaaaaaaboaaaaaaaaa6azgaaaaaaacaaaaaaaaaagaaaaaaaaa9f7/bwaaaabgakaaaaaaaauaaaaaaaaa4ajaaaaaaaagaaaaaaaaaiacqaaaaaaacg...
...And 2 more matches

MCD, Mission Control Desktop, AKA AutoConfig - Archive of obsolete content
build install mercurial tools [root@b008-02 ~]# yum install mercurial installed: mercurial.i586 0:1.2.1-1.fc11 check merge tools in [root@b008-02 ~]# vim /etc/mercurial/hgrc.d/mergetools.rc get the source comm-central [root@b008-02 moz]# time hg clone http://hg.mozilla.org/comm-central/ commsrc requesting all changes adding changesets adding manifests adding file changes added 2975 changesets with 16793 changes to 7117 files (+3 heads) updating working directory 5644 files updated, 0 files merged, 0 files removed, 0 files unresolved real 0m40.771s user 0m...
...9.284s sys 0m1.304s [root@b008-02 commsrc]# python client.py checkout executing command: ['hg', 'pull', '-r', './.', '-r', 'tip'] pulling from http://hg.mozilla.org/comm-central/ searching for changes no changes found executing command: ['hg', 'update', '-r', 'default', '-r', './.'] 0 files updated, 0 files merged, 0 files removed, 0 files unresolved updated to revision c10119db13cad9797b05750bfe18a57261a88922.
... executing command: ['hg', 'clone', 'http://hg.mozilla.org/releases/mozilla-1.9.1/', './mozilla'] requesting all changes adding changesets ...
...And 2 more matches

Tamarin build documentation - Archive of obsolete content
use the following command to create a copy of the tamarin repository: $ hg clone http://hg.mozilla.org/tamarin-central tamarin-central tips for working with mercurial can be found here.
...nor does any other brand of make.) with the right prerequisites, use these commands to build tamarin: $ hg clone http://hg.mozilla.org/tamarin-redux/ $ cd tamarin-redux $ mkdir objdir-release $ cd objdir-release $ python ../configure.py $ make ...
...ent $ export android_toolchain=<full path to your android sdk/ndk top folder> $ export android_ndk=$android_toolchain/android-ndk $ export android_ndk_bin=$android_ndk/toolchains/arm-linux-androideabi-4.4.3/prebuilt/darwin-x86/bin $ export android_sdk=$android_toolchain/android-sdk-mac_86 $ export path=$path:$android_sdk/platform-tools:$android_ndk_bin - example commands to build tamarin: $ hg clone http://hg.mozilla.org/tamarin-redux $ cd tamarin-redux $ mkdir objdir-release $ cd objdir-release $ ../configure.py --arm-arch=armv7-a --target=arm-android $ make to make a debug shell use this command: ../configure.py --enable-debug --arm-arch=armv7-a --target=arm-android using cross-platform scripts in cygwin on windows: prerequisites: you need python 2.5 or later and gnu make 3.81 ...
...And 2 more matches

Simple Thunderbird build
it now needs to be placed inside the mozilla source code, in a directory named comm/ (this is inverse from thunderbird 59 and earlier): hg clone https://hg.mozilla.org/mozilla-central source/ cd source/ hg clone https://hg.mozilla.org/comm-central comm/ the source code requires 3.6gb of free space or more and additionally 5gb or more for default build.
...for hg tip, you should see green bs on https://treeherder.mozilla.org/#/jobs?repo=comm-central to start the build, cd into the source directory, and run: ./mach build mach is our command-line tool to streamline common developer tasks.
...to run the executable from your comm-central working directory: windows: obj-.../dist/bin/thunderbird.exe linux: obj-.../dist/bin/thunderbird macos: obj-.../dist/daily.app/contents/macos/thunderbird how to update and build again in your source directory: hg pull -u cd comm hg pull -u cd ..
...And 2 more matches

Localizing without a specialized tool
folder structure throughout this document, we will be using the following folder structure in all examples: your working directory (root) mozilla-1.9.2 (en-us source, pulled from http://hg.mozilla.org/releases/mozilla-1.9.2) l10n-mozilla-1.9.2 (a directory containing localization directories, one dir per localization; often referred to as "l10n base") x-testing (a directory with your localization files) please either follow this structure closely or adjust all commands in the documentation as needed by your custom set-up.
...assuming that you have installed mercurial, issue the following command: $ hg clone http://hg.mozilla.org/releases/mozilla-1.9.2 this will pull the mozilla 1.9.2 sources from the remote repository and create a mercurial clone in mozilla-1.9.2 inside your working directory.
...depending on your case, you can do it in one of the following ways: if no localization exists yet, create an empty folder and create a mercurial repository in it: $ mkdir x-testing $ cd x-testing $ hg init if there is a bitbucket repository with localization files, you can pull from it.
...And 2 more matches

Initial setup
hg (mercurial) mercurial is the revision control environment that houses the main mozilla source code as well as localized code for each official mozilla localization.
...hg commit access is not necessary to begin localizing.
... after you have some experience with hg, you may want to get commit access.
...And 2 more matches

Using the Web Speech API - Web APIs
chrome support as mentioned earlier, chrome currently supports speech recognition with prefixed properties, therefore at the start of our code we include these lines to feed the right objects to chrome, and any future implementations that might support the features without a prefix: var speechrecognition = speechrecognition || webkitspeechrecognition var speechgrammarlist = speechgrammarlist || webkitspeechgrammarlist var speechrecognitionevent = speechrecognitionevent || webkitspeechrecognitionevent the grammar the next part of our code defines the grammar we want our app to recognise.
...we also create a new speech grammar list to contain our grammar, using the speechgrammarlist() constructor.
... var recognition = new speechrecognition(); var speechrecognitionlist = new speechgrammarlist(); we add our grammar to the list using the speechgrammarlist.addfromstring() method.
...And 2 more matches

Static Analysis for Windows Code under Linux - Archive of obsolete content
dehydra requires patching gcc such that it can load plugins as shared libraries: # prepare a directory mkdir $home/dehydra cd $home/dehydra #obtain gcc 4.3 sources wget ftp://mirrors.kernel.org/gnu/gcc/gcc...-4.3.0.tar.bz2 tar jxvf gcc-4.3.0.tar.bz2 # get the patches which enable plugins cd gcc-4.3.0/ # create an hg repository.
... this makes it easy to apply patches, they can be applied manually hg init .
... hg clone http://hg.mozilla.org/users/tglek_mo...-moz-plugin-mq .hg/patches # apply gty.diff and plugin.diff # if you have mq setup, do hg qpush -a (for file in `cat .hg/patches/series`; do cat .hg/patches/$file; done) |patch -p1 cd ..
...you can obtain mozilla 2 code by: hg clone http://hg.mozilla.org/mozilla-central/ and compose a .mozconfig file for cross-compiling mozilla with static analysis hooked: #specify the cross compile cross_compile=1 ac_add_options --enable-application=browser ac_add_options --host=i686-linux ac_add_options --target=i686-mingw32 ac_add_options --enable-default-toolkit=cairo-windows mk_add_options moz_objdir=@topsrcdir@/../mozilla-ming...

Tamarin mercurial commit hook - Archive of obsolete content
installing the commit hook the easiest way to implement the hook is to sync to the tip of tamarin-redux then add the following to your tamarin-redux/.hg/hgrc file (or to ~/.hgrc to implement for all local repos): [hooks] pretxncommit.commit = python:/path/to/tamarin-redux/utils/hooks/tamarin-commit-hook.py:master_hook once added, all commits will run the commit hook.
... when a violation is found the following will be displayed: > hg commit -m "change with a tab" tab(s) found in test/test.txt for rev 1458 (change 53543674b8e6): @@ -65,4 +65,6 @@ +# tab here ^ (n)o, (y)es, (a)llow tabs for current file are you sure you want to commit this change?
...if you choose to abort the commit, the commit message will be saved to .hg/commit.save.
... this allows you to reuse the commit message after fixing the issue by using the -l (--logfile) option: hg commit -l /reporoot/.hg/commit.save notes at the moment this is a local-only hook and is not enforced on the server.

XML - Archive of obsolete content
an actual memo using the memoml to represent itself might look like this: <memo> <from>ian oeschger</from> <to>steve rudman</to> <body>i think the first draft of the guide is done!</body> </memo> note how the memo element -- the root element in our brief definition, ordeclaration, above -- surrounds the other three elements.
...oeschger other documents: xml in mozilla original document information author(s): ian t.
... oeschger last updated date: november 13, 2001 copyright information: copyright (c) ian t.
... oeschger ...

Old Thunderbird build
get the latest source code from mozilla's comm-central mercurial code repository: hg clone https://hg.mozilla.org/comm-central then, get all the repositories it depends on.
...first, cd into the comm-central subdirectory (created automatically by the previous command): cd comm-central then run: python client.py checkout on some types of network connections, "hg clone" might fail because it gets interrupted.
...for hg tip, you should see green bs on https://treeherder.mozilla.org/#/jobs?repo=comm-central to start the build, cd into the comm-central subdirectory, and run: ./mozilla/mach build mach is our command-line tool to streamline common developer tasks.
...closed), you may wish to consider building one of the branches (to pull the source code from a branch, just replace the url to the repository in the hg clone instruction).

Patching a Localization
cd ~/localization-workdir clone the localization repository for your locale and for the version you want to patch: hg clone http://hg.mozilla.org/releases/l10n/mozilla-aurora/gl now that you have the code and your working directory, edit the dtd and properties files to make your necessary changes.
... hg diff this command creates a patch and lists your modifications through displaying the differences in a unified patch's files.
...hg diff browser/chrome/browser/browser.dtd attach the patch to an existing bug for reference or review or create a new one if one doesn't currently exist.
... hg diff > path/to/patchfile ...

JS_NewObject
syntax // added in spidermonkey 45 jsobject * js_newobject(jscontext *cx, const jsclass *clasp); bool js_newobjectwithgivenproto(jscontext *cx, const jsclass *clasp, js::handle<jsobject*> proto); // obsolete since spidermonkey 38 jsobject * js_newobject(jscontext *cx, const jsclass *clasp, js::handle<jsobject*> proto, js::handle<jsobject*> parent); jsobject * js_newobjectwithgivenproto(jscontext *cx, const jsclass *clasp, js::handle<jsobject*> proto, js::handle<jsobject*> parent); // added in spidermonkey 1.8 name type description cx jscontext * the context in which to create the new object.
... js_newobjectwithgivenproto: if this is null, the new object has no prototype; its __proto__ property is undefined.
... added in spidermonkey 1.8 js_newobjectwithgivenproto creates a new object with the specified prototype.
... see also mxr id search for js_newobject mxr id search for js_newobjectwithgivenproto js_newglobalobject js_newarrayobject js_valuetoobject bug 408871 bug 1136906, bug 1136345 -- remove parent parameter bug 1125567 -- change prototype lookup behaviour ...

Rich-Text Editing in Mozilla - Developer guides
n3nn0ydpbh1abrpt4lfqtqkc3jrkkneisiiribbehjjpklivo4m1rrmkkjqirmjruqudkpt71qpipirkpaqdf55tv5vvuszjqtjolseukd3xu/3dpzusc/22wtu2wrn+jg5so/ocdh8ycmjdflehmlkjkvk7kuyn+ufza/rtth76zavocdptrxzqtni3mrwupc+6cktlxz/sddp2uu9uxlmyxz6qm8v4tz8lhf1h+zdqxt7s8olmxtbf4e8qafhjj3kbp2mzkkthpitjp9vh6ihia+whtasx5brpwuemgdondf/2a4m7ukds1jw662+xkqtkeuoqjktojm2h53yfl15psj04zc94wdtibr26fxlc2mzrvbccebz2kirfd414tkmlezbvgt33+qcohgha81swysew0r1uzfnylmtpx80pngqq91lwvk2jgvgnfvzg6ycyrat16gftw5kkkfo1eqltfh5q2ett0biwf+aitq4fdbk+imyo1oxvgf03wafjqvbckvdffryetxqiffygazths0zwagd7fg5tnnyntp8/fzvgwjofmgg7gox0sakkgqgdmgkbi0njgmeimpgdk5+wacewed0ywblhguz4hw5oduekrblt7dtgdegxacsiznx8zpmwh7k4rkpjcuhdxcul6mdsmmbxdlwch2+xozsgbnzsncee4euyv4pwcpswypw0uhdybkswu1nyjendreqtkjwn2+zvttc1vmstb/mvev/weyslasslimcohobjxw+n3ap/sjefnl5gepzmpu4kg7opr1+tof...
...deredlist');" src="data:image/gif;base64,r0lgodlhfgawamigaaaaadljwlie35gjuaezxtha7p///////yh5baeaaacalaaaaaawabyaaam2elrc/jdksespwjorfvggcbubotfbeq6qiaysqnrhaeozyaz07lu9lubnc0ugqu1k52s6n5oeads=" /> <img class="intlink" title="dotted list" onclick="formatdoc('insertunorderedlist');" src="data:image/gif;base64,r0lgodlhfgawamigaaaaab1chf9vj1ie33morqezxv///////yh5baeaaacalaaaaaawabyaaamyelrc/jdksesppnhgrlbakizrerbbqm6ytnbfmy7lud64uwiukniggqliquwoykqykgaaow==" /> <img class="intlink" title="quote" onclick="formatdoc('formatblock','blockquote');" src="data:image/gif;base64,r0lgodlhfgawaiqxac1nqjfrjkbgmt9nqujnsk9xrfj7u2r9qmkbt1igzhmorm6sz4oxw3odz4cl2zsnw6kxyqo306k63bg70btb0rdi3bvi4p///////////////////////////////////yh5baekab8alaaaaaawabyaaavp4ceozgmeakqubes2cekkervei1zzuogyflakecezfi0ggtgkebatfmja...
...50b/x8gemmpgugwhjnzxodkso5oquogo5khbwwesymqscrdhu9voyk5tm9zspfsr9gsjwiaow==" /> <img class="intlink" title="hyperlink" onclick="var slnk=prompt('write the url here','http:\/\/');if(slnk&&slnk!=''&&slnk!='http://'){formatdoc('createlink',slnk)}" src="data:image/gif;base64,r0lgodlhfgawaomkab1chdrly19vj3morpgjuaezxrcztb/i19ha7pv8/f///////////////////////yh5baekaa8alaaaaaawabyaaary8mljq7046827/2byiqvhhg9pegvgiklydeuby/rle4fqf4dcj2aqxaijqdcwqcaebwiioemqbgsafhdagghgi9xghahmnoszgjkjei33uesv2+/4vd4taqa7" /> <img class="intlink" title="cut" onclick="formatdoc('cut');" src="data:image/gif;base64,r0lgodlhfgawaiqsab1chbfnsrjtysjywjljwkxwl19vj1dusyodhl6mnhmorpqbmpgjuaezxrcztcdcxl/i18rl1p///////////////////////////////////////////////////////yh5baeaab8alaaaaaawabyaaavu4ceozgmeakqubds6tnnebgnapng0kbgmi5trw...
..." /> <img class="intlink" title="copy" onclick="formatdoc('copy');" src="data:image/gif;base64,r0lgodlhfgawaiqcab1chbfnstrlyyjywjljwl9vj1ie31igzf6mnhwx9hodz5gjuycl2ykl8zot4qezxqk63ak/9kpd+7di3b/i17lm/mrl1mly9nha7ops++bx/pv8/f///////////////yh5baeaab8alaaaaaawabyaaawg4ceozgmeakquboum1sq/kpvow749bevsus2cgrcxhptlbboqxcsnccaf1guqwqbbd0jgjaygjjiobe+lncadcxaaeoxhqacgnw0fqx9kp+wmargyfbqneaogihcajqsckjakohgxew8blqycioohf5o7ea+kc40qbkkaaagrpy+wsbkziieaow==" /> <img class="intlink" title="paste" onclick="formatdoc('paste');" src="data:image/gif;base64,r0lgodlhfgawaiquad04ktrly2txqf9vj414wzwibxmorpqbmpgjudclfaezxsa0cb/i1+3yitha7prkiphvbups+/fvrvv8/f///////////////////////////////////////////////yh5baeaab8alaaaaaawabyaaawn4ceozgmeakqubgsuspvbsyfjjvds6njlb0khr4akbcmfscgbqaocwjf5gwquvyksfbwze+awibv0ghfog2...

Making content editable - Developer guides
n3nn0ydpbh1abrpt4lfqtqkc3jrkkneisiiribbehjjpklivo4m1rrmkkjqirmjruqudkpt71qpipirkpaqdf55tv5vvuszjqtjolseukd3xu/3dpzusc/22wtu2wrn+jg5so/ocdh8ycmjdflehmlkjkvk7kuyn+ufza/rtth76zavocdptrxzqtni3mrwupc+6cktlxz/sddp2uu9uxlmyxz6qm8v4tz8lhf1h+zdqxt7s8olmxtbf4e8qafhjj3kbp2mzkkthpitjp9vh6ihia+whtasx5brpwuemgdondf/2a4m7ukds1jw662+xkqtkeuoqjktojm2h53yfl15psj04zc94wdtibr26fxlc2mzrvbccebz2kirfd414tkmlezbvgt33+qcohgha81swysew0r1uzfnylmtpx80pngqq91lwvk2jgvgnfvzg6ycyrat16gftw5kkkfo1eqltfh5q2ett0biwf+aitq4fdbk+imyo1oxvgf03wafjqvbckvdffryetxqiffygazths0zwagd7fg5tnnyntp8/fzvgwjofmgg7gox0sakkgqgdmgkbi0njgmeimpgdk5+wacewed0ywblhguz4hw5oduekrblt7dtgdegxacsiznx8zpmwh7k4rkpjcuhdxcul6mdsmmbxdlwch2+xozsgbnzsncee4euyv4pwcpswypw0uhdybkswu1nyjendreqtkjwn2+zvttc1vmstb/mvev/weyslasslimcohobjxw+n3ap/sjefnl5gepzmpu4kg7opr1+tof...
...deredlist');" src="data:image/gif;base64,r0lgodlhfgawamigaaaaadljwlie35gjuaezxtha7p///////yh5baeaaacalaaaaaawabyaaam2elrc/jdksespwjorfvggcbubotfbeq6qiaysqnrhaeozyaz07lu9lubnc0ugqu1k52s6n5oeads=" /> <img class="intlink" title="dotted list" onclick="formatdoc('insertunorderedlist');" src="data:image/gif;base64,r0lgodlhfgawamigaaaaab1chf9vj1ie33morqezxv///////yh5baeaaacalaaaaaawabyaaamyelrc/jdksesppnhgrlbakizrerbbqm6ytnbfmy7lud64uwiukniggqliquwoykqykgaaow==" /> <img class="intlink" title="quote" onclick="formatdoc('formatblock','blockquote');" src="data:image/gif;base64,r0lgodlhfgawaiqxac1nqjfrjkbgmt9nqujnsk9xrfj7u2r9qmkbt1igzhmorm6sz4oxw3odz4cl2zsnw6kxyqo306k63bg70btb0rdi3bvi4p///////////////////////////////////yh5baekab8alaaaaaawabyaaavp4ceozgmeakqubes2cekkervei1zzuogyflakecezfi0ggtgkebatfmja...
...50b/x8gemmpgugwhjnzxodkso5oquogo5khbwwesymqscrdhu9voyk5tm9zspfsr9gsjwiaow==" /> <img class="intlink" title="hyperlink" onclick="var slnk=prompt('write the url here','http:\/\/');if(slnk&&slnk!=''&&slnk!='http://'){formatdoc('createlink',slnk)}" src="data:image/gif;base64,r0lgodlhfgawaomkab1chdrly19vj3morpgjuaezxrcztb/i19ha7pv8/f///////////////////////yh5baekaa8alaaaaaawabyaaary8mljq7046827/2byiqvhhg9pegvgiklydeuby/rle4fqf4dcj2aqxaijqdcwqcaebwiioemqbgsafhdagghgi9xghahmnoszgjkjei33uesv2+/4vd4taqa7" /> <img class="intlink" title="cut" onclick="formatdoc('cut');" src="data:image/gif;base64,r0lgodlhfgawaiqsab1chbfnsrjtysjywjljwkxwl19vj1dusyodhl6mnhmorpqbmpgjuaezxrcztcdcxl/i18rl1p///////////////////////////////////////////////////////yh5baeaab8alaaaaaawabyaaavu4ceozgmeakqubds6tnnebgnapng0kbgmi5trw...
..." /> <img class="intlink" title="copy" onclick="formatdoc('copy');" src="data:image/gif;base64,r0lgodlhfgawaiqcab1chbfnstrlyyjywjljwl9vj1ie31igzf6mnhwx9hodz5gjuycl2ykl8zot4qezxqk63ak/9kpd+7di3b/i17lm/mrl1mly9nha7ops++bx/pv8/f///////////////yh5baeaab8alaaaaaawabyaaawg4ceozgmeakquboum1sq/kpvow749bevsus2cgrcxhptlbboqxcsnccaf1guqwqbbd0jgjaygjjiobe+lncadcxaaeoxhqacgnw0fqx9kp+wmargyfbqneaogihcajqsckjakohgxew8blqycioohf5o7ea+kc40qbkkaaagrpy+wsbkziieaow==" /> <img class="intlink" title="paste" onclick="formatdoc('paste');" src="data:image/gif;base64,r0lgodlhfgawaiquad04ktrly2txqf9vj414wzwibxmorpqbmpgjudclfaezxsa0cb/i1+3yitha7prkiphvbups+/fvrvv8/f///////////////////////////////////////////////yh5baeaab8alaaaaaawabyaaawn4ceozgmeakqubgsuspvbsyfjjvds6njlb0khr4akbcmfscgbqaocwjf5gwquvyksfbwze+awibv0ghfog2...

Tamarin Tracing Build Documentation - Archive of obsolete content
use the following command to create a copy of the tamarin repository: $ hg clone http://hg.mozilla.org/tamarin-tracing tamarin-tracing building tamarin building tamarin will create all the libraries for the avmplus and garbage collector (mmgc), and create a standalone executable, avmshell, for executing files in the abc file format.
...nor does any other brand of make.) with the right prerequisites, use these commands to build tamarin tracing: $ hg clone http://hg.mozilla.org/tamarin-tracing $ cd tamarin-tracing $ mkdir objdir-debug $ cd objdir-debug $ python ../configure.py --enable-shell $ make ...
...note: only repositories hosted on http://hg.mozilla.org/ are accepted.

Obsolete Build Caveats and Tips
to get this code, do the following: # pull the mozilla source to the folder 20src/ - may take a while # as hundreds of megabytes of history is downloaded to .hg hg clone https://hg.mozilla.org/releases/mozilla-2.0/ 20src cd 20src mozilla-1.9.2 (firefox 3.6) code for the firefox 3.6 (gecko 1.9.2) release lives in releases/mozilla-1.9.2.
... to get this code, do the following: # pull the mozilla source to the folder 192src/ - may take a while # as hundreds of megabytes of history is downloaded to .hg hg clone https://hg.mozilla.org/releases/mozilla-1.9.2/ 192src cd 192src mozilla-1.9.1 (firefox 3.5) code for the firefox 3.5 (gecko 1.9.1) release lives in releases/mozilla-1.9.1.
... to get this code, do the following: # pull the mozilla source to the folder 191src/ - may take a while # as hundreds of megabytes of history is downloaded to .hg hg clone https://hg.mozilla.org/releases/mozilla-1.9.1/ 191src cd 191src note: starting with gecko 5.0, you can actually build firefox without a .mozconfig file.

Index
24 localizing with mercurial build documentation, internationalization, localization in mozilla, we use the the mercurial version control system (hg) to manage our source code and localizations.
... mercurial allows localizers to work locally (on their machines) and then push (an hg term) changes to a remote repository, which usually is hosted on the mozilla servers (hg.mozilla.org).
...if the documentation is incomplete or you have questions, please drop by the #l10n or #hg channels on irc.mozilla.org.

Translation phase
if your locale has an hg repository hosted on the mozilla servers, you can track your localization's current progress by visiting the l10n dashboards.
... note: if you are starting a new localization and decide to use an offline tool for localizing mozilla applications, you will need to become familiar with using mercurial (hg).
... visit the tutorial on using hg in your localization efforts here.

Patches and pushes
create a patch of the searchplugins directory by entering the following command in your command-line tool, where mypatch.diff is where you give your patch a name: $ hg add mozilla/browser/searchplugins/ $ hg diff mozilla/browser/searchplugins/ > mypatch.diff attach your patch file to the bug by clicking the "add an attachment" link.
...for example: hg ci -m "bug 654321, copied the comment from the doc without reading, r=nobody" path-to-changed-files close the bug, copying the url to your change in the closing comment.
... write up something like this for your comment: landed this on aurora, http://hg.mozilla.org/releases/l10n/mozilla-aurora/ab-cd/rev/adfe1234feac, marking fixed.

Getting SpiderMonkey source code
getting the latest spidermonkey source code from mercurial the mercurial repository at https://hg.mozilla.org/mozilla-central/ hosts the latest spidermonkey sources.
... mercurial is also known as hg.
... hg clone https://hg.mozilla.org/mozilla-central/ cd js/src to avoid getting the full change history, click the zip or gz links at https://hg.mozilla.org/index.cgi/mozilla-central/file/tip.

TPS Tab Lists
for example: var tabs1 = [ { uri: "http://hg.mozilla.org/automation/crossweave/raw-file/2d9aca9585b6/pages/page1.html", title: "crossweave test page 1", profile: "profile1" }, { uri: "data:text/html,<html><head><title>hello</title></head><body>hello</body></html>", title: "hello", profile: "profile1" } ]; tab lists and phase actions tabs cannot be modified or deleted, only added or verified with the following functions: tabs.add - opens the specified tabs in the browser window.
... there are a handful of static pages at http://hg.mozilla.org/services/tps/file/tip/pages which can be used for tab testing, and data: url's can be used as well.
... example see the tps tabs unit test: http://hg.mozilla.org/services/tps/f...s/test_tabs.js ...

connectGATT() - Web APIs
the bluetoothdevice.connectgatt() method returns a promise that resolves to an instance of bluetoothgattremoteserver.
... syntax instanceofbluetoothdevice.connectgatt().then(function(bluetoothgattremoteserver) { ...
... }) returns a promise that resolves to an instance of bluetoothgattremoteserver.

BluetoothRemoteGATTCharacteristic.getDescriptor() - Web APIs
the bluetoothremotegattcharacteristic.getdescriptor() method returns a promise that resolves to the first bluetoothgattdescriptor for a given descriptor uuid.
... syntax bluetoothremotegattcharacteristic.getdescriptor(bluetoothdescriptoruuid).then(function(bluetoothgattdescriptor) { ...
... }) returns a promise that resolves to the first bluetoothgattdescriptor.

BluetoothRemoteGATTCharacteristic.getDescriptors() - Web APIs
the bluetoothremotegattcharacteristic.getdescriptors() method returns a promise that resolves to an array of all bluetoothgattdescriptor objects for a given descriptor uuid.
... syntax bluetoothremotegattcharacteristic.getdescriptors(bluetoothdescriptoruuid).then(function(bluetoothgattdescriptors[]) { ...
... }) returns a promise that resolves to an array of bluetoothgattdescriptor objects.

BluetoothRemoteGATTCharacteristic - Web APIs
toruuid descriptor); promise<dataview> readvalue(); promise<void> writevalue(buffersource value); promise<void> startnotifications(); promise<void> stopnotifications(); }; bluetoothremotegattcharacteristic implements eventtarget; bluetoothremotegattcharacteristic implements characteristiceventhandlers; properties bluetoothremotegattcharacteristic.serviceread only returns the bluetoothgattservice this characteristic belongs to.
... methods bluetoothremotegattcharacteristic.getdescriptor() returns a promise that resolves to the first bluetoothgattdescriptor for a given descriptor uuid.
... bluetoothremotegattcharacteristic.getdescriptors() returns a promise that resolves to an array of all bluetoothgattdescriptor objects for a given descriptor uuid.

BluetoothRemoteGATTServer.getPrimaryService() - Web APIs
the bluetoothremotegattserver.getprimaryservice() method returns a promise to the primary bluetoothgattservice offered by the bluetooth device for a specified bluetoothserviceuuid.
... syntax bluetoothremotegattserver.getprimaryservice(bluetoothserviceuuid).then(function(bluetoothgattservice) { ...
... }) returns a promise that resolves to a bluetoothgattservice object.

BluetoothRemoteGATTServer.getPrimaryServices() - Web APIs
the bluetoothremotegattserver.getprimaryservices() method returns a promise to a list of primary bluetoothgattservice objects offered by the bluetooth device for a specified bluetoothserviceuuid.
... syntax bluetoothremotegattserver.getprimaryservices(bluetoothserviceuuid).then(function(bluetoothgattservices) { ...
... }) returns a promise that resolves to a list of bluetoothgattservice objects.

getCharacteristic() - Web APIs
the bluetoothgattservice.getcharacteristic() method returns a promise to an instance of bluetoothgattcharacteristic for a given universally unique identifier (uuid).
... syntax bluetoothgattserviceinstance.getcharacteristic(characteristic).then(function(bluetoothgattcharacteristic) { ...
... } ) returns a promise to an instance of bluetoothgattcharacteristic parameters characteristic the uuid of a characteristic, for example '00002a37-0000-1000-8000-00805f9b34fb' for the heart rate measurement characteristic.

getCharacteristics() - Web APIs
the bluetoothgattservice.getcharacteristics() method returns a promise to a list of bluetoothgattcharacteristic instances for a given universally unique identifier (uuid).
... syntax bluetoothgattserviceinstance.getcharacteristics(characteristics).then(function(bluetoothgattcharacteristic[]) { ...
... } ) returns a promise to an array of bluetoothgattcharacteristic instances.

getIncludedService() - Web APIs
the bluetoothgattservice.getincludedservice() method returns a promise to an instance of bluetoothgattservice for a given universally unique identifier (uuid).
... syntax bluetoothgattserviceinstance.getincludedservice(service).then(function(bluetoothgattservice) { ...
... } ) returns a promise to an instance of bluetoothgattservice.

getIncludedServices() - Web APIs
the bluetoothgattservice.getincludedservices() method returns a promise to an array of bluetoothgattservice instances for an optional universally unique identifier (uuid).
... syntax bluetoothgattserviceinstance.getincludedservice(service).then(function(bluetoothgattservice) { ...
... } ) returns a promise to an instance of bluetoothgattservice.

BluetoothRemoteGATTService - Web APIs
interface interface bluetoothremotegattservice : serviceeventhandlers { readonly attribute uuid uuid; readonly attribute boolean isprimary; readonly attribute bluetoothdevice device; promise<bluetoothgattcharacteristic> getcharacteristic(bluetoothcharacteristicuuid characteristic); promise<sequence<bluetoothgattcharacteristic>> getcharacteristics(optional bluetoothcharacteristicuuid characteristic); promise<bluetoothgattservice> getincludedservice(bluetoothserviceuuid service); promise<sequence<bluetoothgattservice>> getincludedservices(optional bluetoothserviceuuid service); }; properti...
... methods bluetoothremotegattservice.getcharacteristic() returns a promise to an instance of bluetoothgattcharacteristic for a given universally unique identifier (uuid).
... bluetoothremotegattservice.getcharacteristics() returns a promise to an array of bluetoothgattcharacteristic instances for an optional universally unique identifier (uuid).

SpeechRecognition.grammars - Web APIs
the grammars property of the speechrecognition interface returns and sets a collection of speechgrammar objects that represent the grammars that will be understood by the current speechrecognition.
... syntax var mygrammars = myspeechrecognition.grammars; myspeechrecognition.grammars = myspeechgrammarlist; value a speechgrammarlist containing the speechgrammar objects that represent your grammar for your app.
... cyan | fuchsia | ghostwhite | gold | goldenrod | gray | green | indigo | ivory | khaki | lavender | lime | linen | magenta | maroon | moccasin | navy | olive | orange | orchid | peru | pink | plum | purple | red | salmon | sienna | silver | snow | tan | teal | thistle | tomato | turquoise | violet | white | yellow ;' var recognition = new speechrecognition(); var speechrecognitionlist = new speechgrammarlist(); speechrecognitionlist.addfromstring(grammar, 1); recognition.grammars = speechrecognitionlist; //recognition.continuous = false; recognition.lang = 'en-us'; recognition.interimresults = false; recognition.maxalternatives = 1; ...

SpeechRecognition - Web APIs
speechrecognition.grammars returns and sets a collection of speechgrammar objects that represent the grammars that will be understood by the current speechrecognition.
... examples in our simple speech color changer example, we create a new speechrecognition object instance using the speechrecognition() constructor, create a new speechgrammarlist, and set it to be the grammar that will be recognised by the speechrecognition instance using the speechrecognition.grammars property.
... cyan | fuchsia | ghostwhite | gold | goldenrod | gray | green | indigo | ivory | khaki | lavender | lime | linen | magenta | maroon | moccasin | navy | olive | orange | orchid | peru | pink | plum | purple | red | salmon | sienna | silver | snow | tan | teal | thistle | tomato | turquoise | violet | white | yellow ;' var recognition = new speechrecognition(); var speechrecognitionlist = new speechgrammarlist(); speechrecognitionlist.addfromstring(grammar, 1); recognition.grammars = speechrecognitionlist; recognition.continuous = false; recognition.lang = 'en-us'; recognition.interimresults = false; recognition.maxalternatives = 1; var diagnostic = document.queryselector('.output'); var bg = document.queryselector('html'); document.body.onclick = function() { recognition.start(); conso...

WebGL best practices - Web APIs
take advantage of universally supported webgl 1 extensions these webgl 1 extensions are universally supported: angle_instanced_arrays ext_blend_minmax oes_element_index_uint oes_standard_derivatives oes_vertex_array_object webgl_debug_renderer_info webgl_lose_context (see also: https://jdashg.github.io/misc/webgl/webgl-feature-levels.html) consider polyfilling these into webglrenderingcontext, like: https://github.com/jdashg/misc/blob/master/webgl/webgl-v1.1.js universally supported limits the minimum requirements for webgl are quite low.
... non-blocking async data download/readback the approach in webgl 2 is analogous to the approach in opengl: https://jdashg.github.io/misc/async-gpu-downloads.html function clientwaitasync(gl, sync, flags, interval_ms) { return new promise((resolve, reject) => { function test() { const res = gl.clientwaitsync(sync, flags, 0); if (res == gl.wait_failed) { reject(); return; } if (res == gl.timeout_expired) { settimeout(test, interval_ms); return; } ...
... demo: https://jdashg.github.io/misc/webgl/device-pixel-presnap.html resizeobserver and 'device-pixel-content-box' on supporting browsers (chromium?), resizeobserver can be used with 'device-pixel-content-box' to request a callback that includes the true device pixel size of an element.

Web Speech API - Web APIs
the speechgrammar interface represents a container for a particular set of grammar that your app should recognise.
... speechgrammar the words or patterns of words that we want the recognition service to recognize.
... speechgrammarlist represents a list of speechgrammar objects.

Content categories - Developer guides
they are: <a>, <abbr>, <address>, <article>, <aside>, <audio>, <b>,<bdo>, <bdi>, <blockquote>, <br>, <button>, <canvas>, <cite>, <code>, <command>, <data>, <datalist>, <del>, <details>, <dfn>, <div>, <dl>, <em>, <embed>, <fieldset>, <figure>, <footer>, <form>, <h1>, <h2>, <h3>, <h4>, <h5>, <h6>, <header>, <hgroup>, <hr>, <i>, <iframe>, <img>, <input>, <ins>, <kbd>, <keygen>, <label>, <main>, <map>, <mark>, <math>, <menu>, <meter>, <nav>, <noscript>, <object>, <ol>, <output>, <p>, <picture>, <pre>, <progress>, <q>, <ruby>, <s>, <samp>, <script>, <section>, <select>, <small>, <span>, <strong>, <sub>, <sup>, <svg>, <table>, <template>, <textarea>, <time>, <ul>, <var>, <video>, <wbr> and text.
... elements belonging to this category are <h1>, <h2>, <h3>, <h4>, <h5>, <h6> and <hgroup>.
... note: the <hgroup> element was removed from the w3c html specification prior to html 5 being finalized, but is still part of the whatwg specification and is at least partially supported by most browsers.

Promise - JavaScript
note that function troublewithgetnumber() ends with a throw().
...true : false ; const parityinfo = { thenumber: value, isodd: isodd }; return parityinfo; } function troublewithgetnumber(reason) { console.error(`trouble getting number: ${reason}`); throw -999; // must "throw" something, to maintain error state down the chain } function promisegetword(parityinfo) { // the "tetheredgetword()" function gets "parityinfo" as closure variable.
...'odd' : 'even'; resolve(parityinfo); } return; } return new promise(tetheredgetword); } (new promise(tetheredgetnumber)) .then(determineparity,troublewithgetnumber) .then(promisegetword) .then((info) => { console.log("got: ",info.thenumber," , ", info.wordevenodd); return info; }) .catch((reason) => { if(reason === -999) { console.error("had previously handled error"); } else { console.error(`trouble with promisegetword(): ${reason}`); } }) .finally((info) => console.log("all done")); advanced exam...

SVG element reference - SVG: Scalable Vector Graphics
<fedistantlight> <fedropshadow> <feflood> <fefunca> <fefuncb> <fefuncg> <fefuncr> <fegaussianblur> <feimage> <femerge> <femergenode> <femorphology> <feoffset> <fepointlight> <fespecularlighting> <fespotlight> <fetile> <feturbulence> <filter> <foreignobject> g <g> h <hatch> <hatchpath> i <image> l <line> <lineargradient> m <marker> <mask> <mesh> <meshgradient> <meshpatch> <meshrow> <metadata> <mpath> p <path> <pattern> <polygon> <polyline> r <radialgradient> <rect> s <script> <set> <solidcolor> <stop> <style> <svg> <switch> <symbol> t <text> <textpath> <title> <tspan> u <unknown> <use> v <view> svg elements by category animation elements <animate>, <animatecolor>, <animatemotion>, <animatetr...
...elighting>, <fedisplacementmap>, <fedropshadow>, <feflood>,<fefunca>, <fefuncb>, <fefuncg>, <fefuncr>,<fegaussianblur>, <feimage>, <femerge>, <femergenode>, <femorphology>, <feoffset>, <fespecularlighting>, <fetile>, <feturbulence> font elements <font>, <font-face>, <font-face-format>, <font-face-name>, <font-face-src>, <font-face-uri>, <hkern>, <vkern> gradient elements <lineargradient>, <meshgradient>, <radialgradient>, <stop> graphics elements <circle>, <ellipse>, <image>, <line>, <mesh>, <path>, <polygon>, <polyline>, <rect>, <text>, <use> graphics referencing elements <mesh>, <use> light source elements <fedistantlight>, <fepointlight>, <fespotlight> never-rendered elements <clippath>, <defs>, <hatch>, <lineargradient>, <marker>, <mask>, <meshgradient>, <metadata>, <pattern>...
..., <radialgradient>, <script>, <style>, <symbol>, <title> paint server elements <hatch>, <lineargradient>, <meshgradient>, <pattern>, <radialgradient>, <solidcolor> renderable elements <a>, <circle>, <ellipse>, <foreignobject>, <g>, <image>, <line>, <mesh>, <path>, <polygon>, <polyline>, <rect>, <svg>, <switch>, <symbol>, <text>, <textpath>, <tspan>, <unknown>, <use> shape elements <circle>, <ellipse>, <line>, <mesh>, <path>, <polygon>, <polyline>, <rect> structural elements <defs>, <g>, <svg>, <symbol>, <use> text content elements <altglyph>, <altglyphdef>, <altglyphitem>, <glyph>, <glyphref>, <textpath>, <text>, <tref>, <tspan> text content child elements <altglyph>, <textpath>, <tref>, <tspan> uncategorized elements <clippath>, <color-profile>, <cursor>, <filter>, <foreignobj...

clipboard - Archive of obsolete content
var clipboard = require("sdk/clipboard"); clipboard.set("data:image/png;base64,ivborw0kggoaaaansuheugaaacaaaaagcaya" + "aabzenr0aaaasuleqvryhe3o0qkaiawd0eyqe3q993aq3cbsukpygfsnty" + "n5ugbqpk0baadgp0brdwxwlweaaaaagpsa3rzdaaaaahgpcgrpganzq2fg" + "bwrr9aaaaabjru5erkjggg%3d%3d"); if the clipboard contains an image, open it in a new tab.
... var clipboard = require("sdk/clipboard"); clipboard.set("data:image/png;base64,ivborw0kggoaaaansuheugaaacaaaaagcaya" + "aabzenr0aaaasuleqvryhe3o0qkaiawd0eyqe3q993aq3cbsukpygfsnty" + "n5ugbqpk0baadgp0brdwxwlweaaaaagpsa3rzdaaaaahgpcgrpganzq2fg" + "bwrr9aaaaabjru5erkjggg%3d%3d", "text"); globals functions set(data, datatype) replace the contents of the user's clipboard with the provided data.

Adding preferences to an extension - Archive of obsolete content
refreshinformation: function() { // because we may be called as a callback, we can't rely on // "this" referring to the right object, so we need to reference // it by its full name var symbol = stockwatcher.tickersymbol; var fullurl = "http://quote.yahoo.com/d/quotes.csv?f=sl1d1t1c1ohgv&e=.csv&s=" + symbol; function inforeceived() { var samplepanel = document.getelementbyid('stockwatcher2'); var output = httprequest.responsetext; if (output.length) { // remove any whitespace from the end of the string output = output.replace(/\w*$/, ""); // build the tooltip string var fieldarray = output.split(","); ...
... samplepanel.label = symbol + ": " + fieldarray[1]; samplepanel.tooltiptext = "chg: " + fieldarray[4] + " | " + "open: " + fieldarray[5] + " | " + "low: " + fieldarray[6] + " | " + "high: " + fieldarray[7] + " | " + "vol: " + fieldarray[8]; } } var httprequest = new xmlhttprequest(); httprequest.open("get", fullurl, true); httprequest.onload = inforeceived; httprequest.send(null); } } note that we use stockwatcher.tickersymbol here instead of this.tickersymbol to get the stock symbol to watch.

Creating a dynamic status bar extension - Archive of obsolete content
refreshinformation: function() { var httprequest = null; var fullurl = 'http://quote.yahoo.com/d/quotes.csv?f=sl1d1t1c1ohgv&e=.csv&s=goog'; // ...
...tput = httprequest.responsetext; if (output.length) { // remove whitespace from the end of the string; // this gets rid of the end-of-line characters output = output.replace(/\w*$/, ''); // build the tooltip string var fieldarray = output.split(','); // assert that fieldarray[0] == 'goog' samplepanel.label = 'goog: ' + fieldarray[1]; samplepanel.tooltiptext = 'chg: ' + fieldarray[4] + ' | ' + 'open: ' + fieldarray[5] + ' | ' + 'low: ' + fieldarray[6] + ' | ' + 'high: ' + fieldarray[7] + ' | ' + 'vol: ' + fieldarray[8]; } } the first thing we do here is get the status bar panel into the variable samplepanel by calling the document.getelementbyid() dom function.

Installing Dehydra - Archive of obsolete content
cd $home hg clone http://hg.mozilla.org/mozilla-central/ cd mozilla-central hg update aurora_base_20110705 cd js/src autoconf-2.13 mkdir $home/obj-js cd $home/obj-js $home/mozilla-central/js/src/configure --enable-optimize --disable-debug make it has to be checked whether later/newer branches (like aurora_base_20120131) are working, too.
...(obsolete dehydra releases can be found on the mozilla ftp site.) hg clone http://hg.mozilla.org/rewriting-and-analysis/dehydra/ cd dehydra export cxx=/usr/bin/g++ ./configure \ --js-headers=$home/obj-js/dist/include \ --js-libs=$home/obj-js make # run dehydra and treehydra tests make check usage dehydra checking can be performed directly within the mozilla build.

Running Tamarin acceptance tests - Archive of obsolete content
$ cd tamarin-redux/test/acceptance $ export asc=/users/build/hg/tamarin-redux/utils/asc.jar $ export builtinabc=/users/build/hg/tamarin-redux/generated/builtin.abc $ export shellabc=/users/build/hg/tamarin-redux/generated/shell_toplevel.abc $ export avm=/users/build/hg/tamarin-redux/objdir-release/shell/avmshell $ python runtests.py tamarin tests started: 2010-09-28 10:37:06.410676 current configuration: x64-mac-tvm-release avm version: 5260:6d1899261bac exec...
...uting 2532 tests against vm: /users/build/hg/builds/5260-6d1899261bac/mac/avmshell_64 2532 running abcasm/abs_helper.as skipping...

Tamarin Build System Documentation - Archive of obsolete content
checkins (hg push) to http://hg.mozilla.org/tamarin-redux and sandbox requests will trigger a buildbot build when all build slaves are idle the next build begins before the build begins buildbot waits for 2 minutes of no checkin activity the build system prioritizes tamarin-redux checkins over sandbox builds when several tamarin-redux checkins occur the newest change is built including all checkins since the ...
...; cd scripts edit environment.sh, change the basedir and buildsdir settings (around line 51) basedir=~/hg/tamarin-redux (path to my test repository) (next line) buildsdir=~/hg/builds (a directory to store downloaded builds) always set current working directory to the scripts directory when running a script run a script (e.g.) ../all/run-acceptance-release.sh <optional hg revision number like 1902> how do i navigate the build status page?

Creating XPI Installer Modules - Archive of obsolete content
"http://www.w3.org/1999/02/22-rdf-syntax-ns#" xmlns:chrome="http://www.mozilla.org/rdf/chrome#"> <!-- list all the packages being supplied --> <rdf:seq about="urn:mozilla:package:root"> <rdf:li resource="urn:mozilla:package:barley"/> </rdf:seq> <!-- package information --> <rdf:description about="urn:mozilla:package:barley" chrome:displayname="barley grain" chrome:author="ian oeschger" chrome:name="barley"> </rdf:description> </rdf:rdf> create a contents.rdf file like the one in the listing above and put it in the content/ subdirectory with the other package resources.
... see also jar packaging the jar file specification original document information author(s): ian oeschger original document: creating new packages for mozilla last updated date: march 8, 2003 copyright information: copyright (c) ian oeschger ...

Useful string methods - Learn web development
h2> <p class="a11y-label">press esc to move focus away from the code area (tab inserts a tab character).</p> <textarea id="code" class="playable-code" style="height: 285px; width: 95%"> const list = document.queryselector('.output ul'); list.innerhtml = ''; let stations = ['man675847583748sjt567654;manchester piccadilly', 'gnf576746573fhdg4737dh4;greenfield', 'liv5hg65hd737456236dch46dg4;liverpool lime street', 'syb4f65hf75f736463;stalybridge', 'hud5767ghtyfyr4536dh45dg45dg3;huddersfield']; for (let i = 0; i < stations.length; i++) { let input = stations[i]; // write your code just below here let result = input; let listitem = document.createelement('li'); listitem.textcontent = result; list.appendchild(listitem);...
...on.value = 'hide solution'; } else { textarea.value = userentry; solution.value = 'show solution'; } updatecode(); }); const jssolution = 'const list = document.queryselector(\'.output ul\');' + '\nlist.innerhtml = \'\';' + '\nlet stations = [\'man675847583748sjt567654;manchester piccadilly\',' + '\n \'gnf576746573fhdg4737dh4;greenfield\',' + '\n \'liv5hg65hd737456236dch46dg4;liverpool lime street\',' + '\n \'syb4f65hf75f736463;stalybridge\',' + '\n \'hud5767ghtyfyr4536dh45dg45dg3;huddersfield\'];' + '\n' + '\nfor (let i = 0; i < stations.length; i++) {' + '\n let input = stations[i];' + '\n let code = input.slice(0,3);' + '\n let semic = input.indexof(\';\');' + '\n let name = input.slice(semic + 1);' + '\n let ...

Continuous Integration
taskcluster and treeherder taskcluster, mozilla's continuous integration (ci) system picks up changes pushed to hg.
... n and ne - nightly build jobs; these jobs are similar to b and be jobs, but are triggered on a periodic basis instead of being triggered by a push to hg.

Creating a Language Pack
$ make ident fx_revision 237dccbcb967 buildid 20091126033851 you can now go back to your source hg clone.
... $ hg update -r 237dccbcb967 3 files updated, 0 files merged, 0 files removed, 0 files unresolved the source code has been updated to the revision the binary was built from.

Simple SeaMonkey build
# get the source # for aurora, use https://hg.mozilla.org/releases/comm-aurora/ and comm-aurora instead # for beta, use https://hg.mozilla.org/releases/comm-beta/ and comm-beta instead # for release, use https://hg.mozilla.org/releases/comm-release/ and comm-release instead hg clone https://hg.mozilla.org/comm-central/ cd comm-central python client.py checkout # set up a basic .mozconfig file echo 'ac_add_options --enable-application=suite'...
... to (possibly) fix this, cd to a dir without spaces before doing the "hg clone" command above.

Contributing to the Mozilla code base
run hg blame on the file and look for the people who have touched the functions you're working on.
... running hg log and looking for regular reviewers might be a solution too.

Reviewer Checklist
trailing whitespace (git diff and splinter view both highlight this, as does hg with the color extension enabled).
...also test with oom-fennec (https://hg.mozilla.org/users/blassey_mozilla.com/oom-fennec/)].

Localization prerequisites
let’s try our entry points: $ hg --version mercurial distributed scm (version 1.3.1) copyright (c) 2005-2009 matt mackall <mpm@selenic.com> and others this is free software; see the source for copying conditions.
... there is no warranty; not even for merchantability or fitness for a particular purpose great, hg works.

Index
227 migration to hg the nspr, nss and related projects have stopped using mozilla'a cvs server, but have migrated to mozilla's hg (mercurial) server.
... each project now lives in its own separate space, they can be found at: https://hg.mozilla.org/projects/nspr/ https://hg.mozilla.org/projects/nss/ https://hg.mozilla.org/projects/jss/ https://hg.mozilla.org/projects/python-nss/ 228 sample manual installation nss no summary!

JSS 4.4.0 Release Notes
distribution information the hg tag is jss_4_4_20170313.
... bugs fixed in jss 4.4.0 this bugzilla query returns all the bugs fixed in nss 4.4.0: https://bugzilla.mozilla.org/buglist.cgi?product=jss&target_milestone=4.4&target_milestone=4.4&bug_status=resolved&resolution=fixed documentation build instructions for jss at https://hg.mozilla.org/projects/jss/file/tip/readme platform information you can check out the source from mercurial via hg clone -r 055aa3ce8a61 https://hg.mozilla.org/projects/jss jss 4.4.0 works with openjdk versions 1.7 or higher we suggest the latest - openjdk 1.8.

NSS 3.15 release notes
distribution information the hg tag is nss_3_15_rtm.
... updated build instructions are available at migration to hg as part of this migration, the source code directory layout has been re-organized.

NSS sources building testing
if you are a software developer and intend to contribute enhancements to nss, you should obtain the latest development snapshot of nss using mercurial/hg (a distributed source control management tool).
... hg clone https://hg.mozilla.org/projects/nspr hg clone https://hg.mozilla.org/projects/nss after the above commands complete, you should have two local directories, named nspr and nss, next to each other.

Python binding for NSS
mozilla source code management (scm) information on march 21, 2013 the nss project switched from using cvs as it's source code manager (scm) to mercurial, also known as hg.
... to check out python-nss source code from mercurial do this: hg clone https://hg.mozilla.org/projects/python-nss the scm tags for various python-nss releases can be found in the release information.

Bytecode Descriptions
format: jof_ic newobject, newobjectwithgroup operands: (uint32_t baseobjindex) stack: ⇒ obj create and push a new object of a predetermined shape.
...for jsop::newobjectwithgroup, the new object has the same group as the template object.

JSAPI reference
ince jsapi 24 js_setglobalobject obsolete since jsapi 25 js_initclass js_initstandardclasses js_resolvestandardclass js_enumeratestandardclasses js_enumerateresolvedstandardclasses obsolete since jsapi 24 js_isrunning js_saveframechain js_restoreframechain js_isassigning obsolete since javascript 1.8.5 js_isconstructing obsolete since jsapi 26 js_isconstructing_possiblywithgiventhisobject obsolete since jsapi 17 js_getscopechain obsolete since javascript 1.8.7 compartments: class jsautocompartment added in spidermonkey 24 js_newglobalobject added in spidermonkey 17 js_entercompartment added in spidermonkey 24 js_leavecompartment added in spidermonkey 24 js_getcompartmentprivate added in spidermonkey 1.8.5 js_setcompartmentprivate added in spidermonkey 1.8...
...ete since jsapi 13 js_newexternalstringwithclosure added in spidermonkey 6 obsolete since jsapi 13 js_getexternalstringclosure added in spidermonkey 6 obsolete since jsapi 13 objects typedef jsobject js_defineobject js_newobject js_newplainobject added in spidermonkey 38 js_newobjectforconstructor added in spidermonkey 1.8.5 js_newglobalobject added in spidermonkey 1.8 js_newobjectwithgivenproto js_new added in spidermonkey 1.8 js_isglobalobject added in jsapi 24 js_constructobject obsolete since jsapi 16 js_constructobjectwitharguments obsolete since jsapi 16 js_getclass js_getobjectprototype added in jsapi 17 js_getfunctionprototype added in spidermonkey 17 js_getarrayprototype added in spidermonkey 24 js_getconstructor js_getglobalforobject js_getinstancep...

SpiderMonkey 1.8.5
js_newobject and js_newobjectwithgivenproto remain the correct apis for creating other objects.
...scriptor js_getpropertyattrsgetterandsetterbyid js_getpropertybyid js_getpropertybyiddefault js_getpropertydefault js_getpropertydescriptorbyid js_getruntimesecuritycallbacks js_getsecuritycallbacks js_getstringcharsandlength js_getstringcharsz js_getstringcharszandlength js_getstringencodinglength js_haspropertybyid js_initctypesclass js_internjsstring js_isconstructing_possiblywithgiventhisobject js_isextensible js_isinrequest js_leavecrosscompartmentcall js_lookuppropertybyid js_lookuppropertywithflagsbyid js_new js_newcompartmentandglobalobject js_newdateobject js_newdateobjectmsec js_newfunctionbyid body new c++ helpers while jsapi remains a c api, the engine is now implemented in c++.

SpiderMonkey 1.8.7
js_newobject and js_newobjectwithgivenproto remain the correct apis for creating other objects.
...scriptor js_getpropertyattrsgetterandsetterbyid js_getpropertybyid js_getpropertybyiddefault js_getpropertydefault js_getpropertydescriptorbyid js_getruntimesecuritycallbacks js_getsecuritycallbacks js_getstringcharsandlength js_getstringcharsz js_getstringcharszandlength js_getstringencodinglength js_haspropertybyid js_initctypesclass js_internjsstring js_isconstructing_possiblywithgiventhisobject js_isextensible js_isinrequest js_leavecrosscompartmentcall js_lookuppropertybyid js_lookuppropertywithflagsbyid js_new js_newcompartmentandglobalobject js_newdateobject js_newdateobjectmsec js_newfunctionbyid body new c++ helpers while jsapi remains a c api, the engine is now implemented in c++.

BluetoothRemoteGATTCharacteristic.service - Web APIs
the bluetoothremotegattcharacteristic.service read-only property returns the bluetoothgattservice this characteristic belongs to.
... syntax var bluetoothremotegattserviceinstance = bluetoothremotegattcharacteristic.service returns an instance bluetoothgattservice.

BluetoothRemoteGATTServer - Web APIs
bluetoothremotegattserver.getprimaryservice() returns a promise to the primary bluetoothgattservice offered by the bluetooth device for a specified bluetoothserviceuuid.
... bluetoothremotegattserver.getprimaryservices() returns a promise to a list of primary bluetoothgattservice objects offered by the bluetooth device for a specified bluetoothserviceuuid.

device - Web APIs
the bluetoothgattservice.device read-only property returns information about a bluetooth device through an instance of bluetoothdevice.
... syntax var bluetoothdeviceinstance = bluetoothgattservice.device returns an instance of bluetoothdevice.

isPrimary - Web APIs
the bluetoothgattservice.isprimary read-only property returns a boolean that indicates whether this is a primary service.
... syntax var isprimary = bluetoothgattservice.isprimary returns a boolean.

uuid - Web APIs
the bluetoothgattservice.uuid read-only property returns a domstring representing the uuid of this service.
... syntax var uuid = bluetoothgattservice.uuid returns a domstring.

SubtleCrypto.importKey() - Web APIs
a pem-encoded subjectpublickeyinfo looks like this: -----begin public key----- miibijanbgkqhkig9w0baqefaaocaq8amiibcgkcaqea3j+hgshunc7f6xzvebd0 r3m5jny+/kabijvu8iu1eral3osi38vgimzjdbdorfxvznnzl+sxahwxiv5bhixl cq6qhwysdgh6oqgkiwialra/wnh4uhxj1or/iyakjhrr/kghutjyvcjzvaqadpjw 2g+syd1ui0b6kjov2cruwipwpff8hbfvwv8q9yc2yd5hcnykvl0iaiyn+sdak/rv 8dc5eilzci4efucbyg4c9o88qz7bs14dxsfapty8p/twoihvvjladf743lgm/jlq cdpubua3hlszuhkm3bbskd7q9ngkjv3+ybyo4/fl+fkyra8j9ypa2n0iw53lfb3b gqidaqab -----end public key----- just as with pkcs #8, to...
...mdtmacr/vu50kdrmlefezyowpaehhmfywybtuzbipvizvp8wfcsknmbfi1s9a9pdbqnebwwhhx3/hsebt2bagmbaaecggeabei1p6nf6zs7mjlybdv+pfl5rjl2coqly6tovvzvblmkcppjyfunipdk2tk2i897zaxfhpdbikmllm2hq6jzqkb110oantpdg0jxzmiihps32s1d/kilhjgff4hjd4nxp1l1dp8bupollorr2tym2x6dccgfw9lhtr8o03qp4hjn84vjgiwadyck83mgs4nrsnhkdiqynwx1ajkly51yek6rcrdmi0th2rxrrinoc35svv+apt2rkomgi52rwtesea1kzgfrxjq61rejif6p2vxecvhex6cwlx014lgk43z6q28p6hgeevefijyqcuea5du/myb/qsrscosxlxbqwqkbgqd1+fdc9zimrvi+km7nx2ckbn8rjrdmuh5sbxn2myjdrud8bynnzkcgkmgxvxsvjrbmvorby2txoiqudzkk5md3e5o/qzwpwqlgru8ueynpobax9nrgnfz7rzd+81vh5mfzixfuzouzv29izhu0oqyz9y75ehkldrernkwyoe5auqkbgqdlzapdi1nxkbgsj9iio4kua7jvd4jjrqfy4zhj/jbqvlvm0f/ufp7sxvchgx4r11c+6icbhx4u+zuu0hgjt4d+hnxmggyxr8fiuvxolotdkvja5sobzk73/9/mbekusdmjprhalzqfmujrwioevdmhfg3tw/rbj5ryatp2dtvumqkbgds8yr52drm...

jpm - Archive of obsolete content
using .jpmignore to ignore files using .jpmignore is similar to using .gitignore with git, .hgignore with mercurial, or .npmignore with npm.

jpmignore - Archive of obsolete content
using .jpmignore to ignore files and directories using .jpmignore is similar to using .gitignore with git, .hgignore with mercurial, or .npmignore with npm.

Offering a context menu for form controls - Archive of obsolete content
this article presents information based on ehsan akhgari's form control context menu extension, which was created specifically to demonstrate how to do this.

Inner-browsing extending the browser navigation paradigm - Archive of obsolete content
.xml ',this);return false;\" title=\"dom articles\">dom</a></span>"); } </script> <!-- ***** this represents the container ***** --> <div style="margin-left:0px;border:1px solid #dddddd;" > <div style="padding:10px;" id="container"> </div> </div> </body> </html> original document information author(s): marcio galli, netscape communications; roger soares, intelinet.com.br; ian oeschger, netscape communications last updated date: published 16 may 2003 copyright information: copyright © 2001-2003 netscape.

Localizing an extension - Archive of obsolete content
create a properties file the first thing we do is create a property file for the literal strings used by the javascript code in stockwatcher2.js: changestring=chg: openstring=open: lowstring=low: highstring=high: volumestring=vol: the stockwatcher2.properties file shown above maps five keys (changestring, openstring, lowstring, highstring, and volumestring) to the corresponding text in english.

Mozilla Application Framework in Detail - Archive of obsolete content
original document information author(s): myk melez, ian oeschger original document: http://www.mozilla.org/why/framework-details.html last updated date: february 15, 2006 copyright information: copyright (c) myk melez, ian oeschger ...

Nanojit - Archive of obsolete content
you can get nanojit by cloning the tamarin-redux mercurial repository at http://hg.mozilla.org/tamarin-redux.

Supporting private browsing mode - Archive of obsolete content
see this blog post by ehsan akhgari for details on the transition period.

Venkman Introduction - Archive of obsolete content
original document information authors: ian oeschger, robert ginda ...

Using Breakpoints in Venkman - Archive of obsolete content
original document information authors: robert ginda, ian oeschger published 02 may 2003 ...

Venkman - Archive of obsolete content
source code the source code for venkman may be found in mercurial at the following url: http://hg.mozilla.org/venkman/summary community view mozilla forums...

Learn XPI Installer Scripting by Example - Archive of obsolete content
original document information author(s): ian oeschger last updated date: 01/26/2006 copyright information: copyright (c) ian oeschger ...

A XUL Bestiary - Archive of obsolete content
these three cross-platform glue technologies fit in the middle of an architecture that looks something like this: author: ian oeschger other documents: mozilla jargon file and introduction to xul original document information author(s): ian oeschger last updated date: april 16, 2000 copyright information: copyright (c) ian oeschger ...

Skinning XUL Files by Hand - Archive of obsolete content
original document information author(s): ian oeschger last updated date: october 3, 2004 copyright information: copyright (c) ian oeschger ...

XUL Event Propagation - Archive of obsolete content
original author: ian oeschger other documents: w3c dom events, mozilla xul events original document information author(s): ian oeschger last updated date: january 18, 2002 copyright information: copyright (c) ian oeschger ...

Building XULRunner - Archive of obsolete content
for example, to build xulrunner with the top of the tree: hg clone http://hg.mozilla.org/mozilla-central/ src cd src echo ".

Using Web Standards in your Web Pages - Archive of obsolete content
contents benefits of using web standards making your page using web standards - how to using the w3c dom developing cross browser and cross platform pages using xmlhttprequest summary of changes references original document information author(s): mike cowperthwaite, marcio galli, jim ley, ian oeschger, simon paquet, gérard talbot last updated date: may 29, 2008 copyright information: portions of this content are © 1998–2008 by individual mozilla.org contributors; content available under a creative commons license | details.

Using workers in extensions - Archive of obsolete content
that file, ticker_worker.js, is shown here: var symbol = ""; function refreshinformation() { if (!symbol) { throw "no symbol set!"; } var fullurl = "http://quote.yahoo.com/d/quotes.csv?f=sl1d1t1c1ohgv&e=.csv&s=" + symbol; function inforeceived() { var output = httprequest.responsetext; if (output) { postmessage(output.trim()); } httprequest = null; } var httprequest = new xmlhttprequest(); httprequest.open("get", fullurl, true); httprequest.onload = inforeceived; httprequest.send(null); } setinterval(function() { refreshinformation(); }, 10*60*1000); ...

Building Mozilla XForms - Archive of obsolete content
starting with firefox 3.5, you need to do two more mercurial checkouts: cd extensions hg clone http://hg.mozilla.org/xforms hg clone http://hg.mozilla.org/schema-validation that's it, you now have everything you need to get started.

Windows Media in Netscape - Archive of obsolete content
original document information authors: arun ranganathan, bob clary, ian oeschger last updated date: 30 jun 2003 copyright information: copyright © 2001-2003 netscape.

XUL Parser in Python - Archive of obsolete content
original document information author: ian oeschger ...

Simple Sunbird build
# get the source hg clone http://hg.mozilla.org/comm-central/ cd comm-central python client.py checkout # setup a basic .mozconfig file echo 'ac_add_options --enable-application=calendar' > .mozconfig # let's build sunbird...

Eclipse CDT
this define is in nsdomclassinfoid.h, which is included via the following include chain: content/svg/content/src/nssvgellipseelement.cpp content/svg/content/src/nssvgpathgeometryelement.h content/svg/content/src/nssvggraphicelement.h content/svg/content/src/nssvgstylableelement.h content/svg/content/src/nssvgelement.h content/base/src/nsgenericelement.h obj-debug/dist/include/nsdomclassinfoid.h in nsdomclassinfoid.h the ns_dom_interface_map_entry_classinfo define is behind an |ifdef _impl_ns_layout|.

Eclipse CDT Manual Setup
select "resource > resource filters" on the left of the window that opens, then use the add button to add the following filters: add an "exclude all" filter for folders with a project relative path matching ".hg".

Overview of Mozilla embedding APIs
interface definition: defining new xpcom components original document information author(s): rpotts, alecf, oeschger at netscape.com last updated date: march 5, 2003 copyright information: creative commons ...

L10n Checks
the easiest way is to just run: $ hg clone http://hg.mozilla.org/users/akalla_aviary.pl/silme-patched/ $ cd silme-patched/ $ sudo python setup.py install or, if you're on windows: $ hg clone http://hg.mozilla.org/users/akalla_aviary.pl/silme-patched/ $ cd silme-patched/ $ python setup.py install running it mercurial source (source) mode l10n checks gathers the directories to compare from an ini file, usually found in $app/locales/...

Profiling with the Firefox Profiler
thgis requires the following command: $ xpcshell -m -i -n -e ' const ci = components.interfaces; const cc = components.classes; var profiler = cc["@mozilla.org/tools/profiler;1"].getservice(ci.nsiprofiler); profiler.startprofiler( 10000000 /* = profiler memory */, 1 /* = sample rate: 100µs with patch, 1ms without */, ["stackwalk", "js"], 2 /* = features, and number of features...

Profile Manager
system requirements: mac: an intel processor, i386 or x86_64 linux: any version capable of running firefox 4.0 windows: xp or later source code you can download the source as well: hg clone http://hg.mozilla.org/automation/profilemanager/ instructions for building can be found in build.txt.

Installing JSHydra
cd $home/jshydra hg clone http://hg.mozilla.org/users/pidgeot18_gmail.com/jshydra/ cd jshydra ./configure make # run jshydra tests make check processing input files jshydra requires the files it processes to be correct js files.

NSPR build instructions
build the libraries build the test programs for example, # check out the source tree from mercurial hg clone https://hg.mozilla.org/projects/nspr # create a build directory mkdir target.debug cd target.debug # run the configure script ../nspr/configure [optional configure options] # build the libraries gmake # build the test programs cd pr/tests gmake on mac os x, use make, which is gnu make.

Building NSS
to check out the latest sources for nss and nspr--which may not be part of a stable release--use the following commands: hg clone https://hg.mozilla.org/projects/nspr hg clone https://hg.mozilla.org/projects/nss to get the source of a specific release, see nss releases.

Getting Started With NSS
you are welcome to download the samples via: hg clone https://hg.mozilla.org/projects/nss; cd nss; hg update samples_branch how to contribute ...

JSS
legacy jss information can still be found at: source: https://hg.mozilla.org/projects/jss issues: https://bugzilla.mozilla.org/buglist.cgi?product=jss wiki: /docs/mozilla/projects/nss/jss network security services for java (jss) is a java interface to nss.

NSS 3.15.3.1 release notes
distribution information the hg tag is nss_3_15_3_1_rtm.

NSS 3.15.3 release notes
distribution information the hg tag is nss_3_15_3_rtm.

NSS 3.15.4 release notes
distribution information the hg tag is nss_3_15_4_rtm.

NSS 3.15.5 release notes
distribution information the hg tag is nss_3_15_5_rtm.

NSS 3.16.1 release notes
distribution information the hg tag is nss_3_16_1_rtm.

NSS 3.16.2.1 release notes
distribution information the hg tag is nss_3_16_2_1_rtm.

NSS 3.16.2.2 release notes
distribution information the hg tag is nss_3_16_2_2_rtm.

NSS 3.16.2.3 release notes
distribution information the hg tag is nss_3_16_2_3_rtm.

NSS 3.16.2 release notes
distribution information the hg tag is nss_3_16_2_rtm.

NSS 3.16.3 release notes
distribution information the hg tag is nss_3_16_3_rtm.

NSS 3.16.4 release notes
distribution information the hg tag is nss_3_16_4_rtm.

NSS 3.16.5 release notes
distribution information the hg tag is nss_3_16_5_rtm.

NSS 3.16.6 release notes
distribution information the hg tag is nss_3_16_6_rtm.

NSS 3.16 release notes
distribution information the hg tag is nss_3_16_rtm.

NSS 3.17.1 release notes
distribution information the hg tag is nss_3_17_1_rtm.

NSS 3.17.2 release notes
distribution information the hg tag is nss_3_17_2_rtm.

NSS 3.17.3 release notes
distribution information the hg tag is nss_3_17_3_rtm.

NSS 3.17.4 release notes
distribution information the hg tag is nss_3_17_4_rtm.

NSS 3.17 release notes
distribution information the hg tag is nss_3_17_rtm.

NSS 3.18.1 release notes
distribution information the hg tag is nss_3_18_1_rtm.

NSS 3.18 release notes
distribution information the hg tag is nss_3_18_rtm.

NSS 3.19.1 release notes
distribution information the hg tag is nss_3_19_1_rtm.

NSS 3.19.2.1 release notes
distribution information the hg tag is nss_3_19_2_1_rtm.

NSS 3.19.2.2 release notes
(current users of nss 3.19.3 or nss 3.19.4 are advised to update to nss 3.20.2, nss 3.21, or a later release.) distribution information the hg tag is nss_3_19_2_2_rtm.

NSS 3.19.2.3 release notes
(current users of nss 3.19.3, nss 3.19.4 or nss 3.20.x are advised to update to nss 3.21.1, nss 3.22.2, or a later release.) distribution information the hg tag is nss_3_19_2_3_rtm.

NSS 3.19.2.4 release notes
(current users of nss 3.19.3, nss 3.19.4 or nss 3.20.x are advised to update to nss 3.21.1, nss 3.22.2 or a later release.) distribution information the hg tag is nss_3_19_2_4_rtm.

NSS 3.19.2 release notes
distribution information the hg tag is nss_3_19_2_rtm.

NSS 3.19.3 release notes
distribution information the hg tag is nss_3_19_3_rtm.

NSS 3.19.4 release notes
distribution information the hg tag is nss_3_19_4_rtm.

NSS 3.19 release notes
distribution information the hg tag is nss_3_19_rtm.

NSS 3.20.1 release notes
distribution information the hg tag is nss_3_20_1_rtm.

NSS 3.20.2 release notes
distribution information the hg tag is nss_3_20_2_rtm.

NSS 3.20 release notes
distribution information the hg tag is nss_3_20_rtm.

NSS 3.21.1 release notes
distribution information the hg tag is nss_3_21_1_rtm.

NSS 3.21.2 release notes
distribution information the hg tag is nss_3_21_2_rtm.

NSS 3.21.3 release notes
distribution information the hg tag is nss_3_21_3_rtm.

NSS 3.21.4 release notes
distribution information the hg tag is nss_3_21_4_rtm.

NSS 3.21 release notes
distribution information the hg tag is nss_3_21_rtm.

NSS 3.22.1 release notes
distribution information the hg tag is nss_3_22_1_rtm.

NSS 3.22.2 release notes
distribution information the hg tag is nss_3_22_2_rtm.

NSS 3.22.3 release notes
distribution information the hg tag is nss_3_22_3_rtm.

NSS 3.22 release notes
distribution information the hg tag is nss_3_22_rtm.

NSS 3.23 release notes
distribution information the hg tag is nss_3_23_rtm.

NSS 3.24 release notes
distribution information the hg tag is nss_3_24_rtm.

NSS 3.25.1 release notes
distribution information the hg tag is nss_3_25_1_rtm.

NSS 3.25 release notes
distribution information the hg tag is nss_3_25_rtm.

NSS 3.26.2 release notes
distribution information the hg tag is nss_3_26_2_rtm.

NSS 3.26 release notes
distribution information the hg tag is nss_3_26_rtm.

NSS 3.27.1 release notes
distribution information the hg tag is nss_3_27_1_rtm.

NSS 3.27.2 Release Notes
distribution information the hg tag is nss_3_27_2_rtm.

NSS 3.27 release notes
distribution information the hg tag is nss_3_27_rtm.

NSS 3.28.1 release notes
distribution information the hg tag is nss_3_28_1_rtm.

NSS 3.28.2 release notes
distribution information the hg tag is nss_3_28_2_rtm.

NSS 3.28.3 release notes
distribution information the hg tag is nss_3_28_3_rtm.

NSS 3.28.4 release notes
distribution information the hg tag is nss_3_28_4_rtm.

NSS 3.28.5 release notes
distribution information the hg tag is nss_3_28_5_rtm.

NSS 3.28 release notes
distribution information the hg tag is nss_3_28_rtm.

NSS 3.29.1 release notes
distribution information the hg tag is nss_3_29_1_rtm.

NSS 3.29.2 release notes
distribution information the hg tag is nss_3_29_2_rtm.

NSS 3.29.3 release notes
distribution information the hg tag is nss_3_29_3_rtm.

NSS 3.29.5 release notes
distribution information the hg tag is nss_3_29_5_rtm.

NSS 3.29 release notes
distribution information the hg tag is nss_3_29_rtm.

NSS 3.30.1 release notes
distribution information the hg tag is nss_3_30_1_rtm.

NSS 3.30.2 release notes
distribution information the hg tag is nss_3_30_2_rtm.

NSS 3.30 release notes
distribution information the hg tag is nss_3_30_rtm.

NSS 3.31.1 release notes
distribution information the hg tag is nss_3_31_1_rtm.

NSS 3.31 release notes
distribution information the hg tag is nss_3_31_rtm.

NSS 3.32 release notes
distribution information the hg tag is nss_3_32_rtm.

NSS 3.33 release notes
distribution information the hg tag is nss_3_33_rtm.

NSS 3.34.1 release notes
distribution information the hg tag is nss_3_34.1_rtm.

NSS 3.34 release notes
distribution information the hg tag is nss_3_34_rtm.

NSS 3.35 release notes
distribution information the hg tag is nss_3_35_rtm.

NSS 3.36.1 release notes
distribution information the hg tag is nss_3_36_1_rtm.

NSS 3.36.2 release notes
distribution information the hg tag is nss_3_36_2_rtm.

NSS 3.36.4 release notes
distribution information the hg tag is nss_3_36_4_rtm.

NSS 3.36.5 release notes
distribution information the hg tag is nss_3_36_5_rtm.

NSS 3.36.6 release notes
distribution information the hg tag is nss_3_36_6_rtm.

NSS 3.36.7 release notes
distribution information the hg tag is nss_3_36_7_rtm.

NSS 3.36.8 release notes
distribution information the hg tag is nss_3_36_8_rtm.

NSS 3.36 release notes
distribution information the hg tag is nss_3_36_rtm.

NSS 3.37.1 release notes
distribution information the hg tag is nss_3_37_1_rtm.

NSS 3.37.3 release notes
distribution information the hg tag is nss_3_37_3_rtm.

NSS 3.37 release notes
distribution information the hg tag is nss_3_37_rtm.

NSS 3.38 release notes
distribution information the hg tag is nss_3_38_rtm.

NSS 3.39 release notes
distribution information the hg tag is nss_3_39_rtm.

NSS 3.40.1 release notes
introduction the nss team has released network security services (nss) 3.40.1, which is a patch release for nss 3.40 distribution information the hg tag is nss_3_40_1_rtm.

NSS 3.40 release notes
distribution information the hg tag is nss_3_40_rtm.

NSS 3.41.1 release notes
distribution information the hg tag is nss_3_41_1_rtm.

NSS 3.41 release notes
distribution information the hg tag is nss_3_41_rtm.

NSS 3.42.1 release notes
distribution information the hg tag is nss_3_42_1_rtm.

NSS 3.42 release notes
distribution information the hg tag is nss_3_42_rtm.

NSS 3.43 release notes
distribution information the hg tag is nss_3_43_rtm.

NSS 3.44.1 release notes
the nss team would like to recognize first-time contributors: greg rubin distribution information the hg tag is nss_3_44_1_rtm.

NSS 3.44.2 release notes
distribution information the hg tag is nss_3_44_2_rtm.

NSS 3.44.3 release notes
the nss team would like to recognize first-time contributors: craig disselkoen distribution information the hg tag is nss_3_44_3_rtm.

NSS 3.44.4 release notes
distribution information the hg tag is nss_3_44_4_rtm.

NSS 3.44 release notes
distribution information the hg tag is nss_3_44_rtm.

NSS 3.45 release notes
the nss team would like to recognize first-time contributors: bastien abadie christopher patton jeremie courreges-anglas marcus burghardt michael shigorin tomas mraz distribution information the hg tag is nss_3_45_rtm.

NSS 3.46.1 release notes
distribution information the hg tag is nss_3_46_1_rtm.

NSS 3.46 release notes
the nss team would like to recognize first-time contributors: giulio benetti louis dassy mike kaganski xhimanshuz distribution information the hg tag is nss_3_46_rtm.

NSS 3.47.1 release notes
the nss team would like to recognize first-time contributors: craig disselkoen distribution information the hg tag is nss_3_47_1_rtm.

NSS 3.47 release notes
the nss team would like to recognize first-time contributors: christian weisgerber deian stefan jenine distribution information the hg tag is nss_3_47_rtm.

NSS 3.48.1 release notes
distribution information the hg tag is nss_3_48_1_rtm.

NSS 3.48 release notes
the nss team would like to recognize first-time contributors: craig disselkoen giulio benetti lauri kasanen tom prince distribution information the hg tag is nss_3_48_rtm.

NSS 3.49.1 release notes
distribution information the hg tag is nss_3_49_1_rtm.

NSS 3.49.2 release notes
distribution information the hg tag is nss_3_49_2_rtm.

NSS 3.49 release notes
the nss team would like to recognize first-time contributors: alex henrie distribution information the hg tag is nss_3_49_rtm.

NSS 3.50 release notes
distribution information the hg tag is nss_3_50_rtm.

NSS 3.51.1 release notes
distribution information the hg tag is nss_3_51_1_rtm.

NSS 3.51 release notes
the nss team would like to recognize first-time contributors: dmitry baryshkov victor tapia distribution information the hg tag is nss_3_51_rtm.

NSS 3.52.1 release notes
distribution information the hg tag is nss_3_52_1_rtm.

NSS 3.52 release notes
the nss team would like to recognize first-time contributors: zhujianwei7 hans petter jansson distribution information the hg tag is nss_3_52_rtm.

NSS 3.53.1 release notes
distribution information the hg tag is nss_3_53_1_rtm.

NSS 3.53 release notes
the nss team would like to recognize first-time contributors: jan-marek glogowski jeff walden distribution information the hg tag is nss_3_53_rtm.

NSS 3.54 release notes
distribution information the hg tag is nss_3_54_rtm.

NSS 3.55 release notes
the nss team would like to recognize first-time contributors: danh distribution information the hg tag is nss_3_55_rtm.

NSS 3.56 release notes
distribution information the hg tag is nss_3_56_rtm.

NSS Sample Code sample5
ibvqibadanbgkqhkig9w0baqefaascat8wgge7ageaakeavcxpmhzckriy6cj5rz89tdb4sm/8v4hfbumlzpziekw1biysw3pag1tpittmmdl1v6t//x1xpcga7nrsldhz4widaqabakeajh8+4qncwcmgivnm6ytbpqt+k/jeoexg2bqhjojvnxn3fazgcefxvpuibcjvfaijs9ybcmozzrato0+k2hwnoqihaoc4nvbo8fqhzs4yxm1m86kml47fa9ui//oufbhladw1aiea2dbmixnsbokb+ohver69p0gnewlvcjc9bjdvfdlvslcciqcptv3vgyjv2vdwxqzqahc+yb4gigaqoqbcbmjd3lyflqiga+vtydunoqwtzwve4grf7izk2v5ccnhg3gr5rgwxn58cigccaforruksm66isg0iti04g9v/w+wmx91wjeeb+qbz" int main(int argc, char **argv) { secstatus rv; certcertificate *cert = null; seckeypublickey *pubkey = null; certsubjectpublickeyinfo *spki = null; seckeyprivatekey *pvtkey = null; int modulus_len, i, outlen; char *buf1 = null; char *buf2 = null; char *...

NSS Sample Code
see https://bugzilla.mozilla.org/show_bug.cgi?id=490238 you are welcome to download the new samples via: hg clone https://hg.mozilla.org/projects/nss; cd nss; hg update samples_branch the new samples: /docs/mozilla/projects/nss/new_nss_samples ...

NSS release notes template
distribution information the hg tag is nss_3_xx_rtm.

New NSS Samples
see https://bugzilla.mozilla.org/show_bug.cgi?id=490238 how to download the samples: hg clone https://hg.mozilla.org/projects/nss; cd nss; hg update samples_branch samples list: sample code 1: hashing sample code 2: init nss database sample code 3: encrypt/decrypt and mac using token sample code 4: encrypt/decrypt and mac using session objects sample code 5: encrypt/decrypt/mac output public key as a csr sample code 6: encrypt/decrypt/mac generating a pkcs#11 csr common code used by these samples: sam...

Build instructions
hg clone https://hg.mozilla.org/projects/nspr hg clone https://hg.mozilla.org/projects/nss if you want to build a releases other than the tips of these repositories, then switch to the release tags: cd nspr hg update nspr_4_9_5_rtm cd ../nss hg update nss_3_14_2_rtm cd ..

Installing Pork
hg clone http://hg.mozilla.org/rewriting-and-analysis/pork/ cd pork hg clone http://hg.mozilla.org/rewriting-and-analysis/elsa ./configure make building mozilla with mcpp to build mozilla with mcpp to generate annotated .ii files, use the following configure command: ac_cv_visibility_hidden=no cc="gcc34 -save-temps -wp,-w0,-k" cxx="g++ -save-temps -wp,-w0,-k" cppflags=-dns_disable_literal_temp...

How to embed the JavaScript engine
you can download a source archive or use mercurial (hg) to pull the spidermonkey repository.

Index
369 js_isconstructing_possiblywithgiventhisobject jsapi, jsapi reference, obsolete, reference, référence(2), spidermonkey in the case of a constructor called from js_constructobject and js_initclass where the class has the jsclass_construct_prototype flag set, spidermonkey passes the constructor a non-standard this object.

JS_GetGCParameter
jsgc_min_last_ditch_gc_period / "minlastditchgcperiod" the minimum time to allow between triggering last ditch gcs in seconds.

SpiderMonkey 1.8
js_newobjectwithgivenproto is exactly like js_newobject except that it doesn't use a default prototype object if you pass null.

SpiderMonkey 24
get it here mozilla-esr24 if the download url is outdate you will find it in "firefox extended support release 24" package on hg release platform support spidermonkey 24 is supported on all the platforms where firefox 24 runs.

SpiderMonkey 31
get it here mozilla-esr31 you will find it in "firefox extended support release 31" package on hg release platform support spidermonkey 31 is supported on all the platforms where firefox 31 runs.

SpiderMonkey 38
get it here mozilla-esr38 you will find it in "firefox extended support release 38" package on hg release platform support spidermonkey 38 is supported on all the platforms where firefox 38 runs.

TPS Formdata Lists
ting", value: "success", date: -1 }, { fieldname: "testing", value: "failure", date: -2 }, { fieldname: "username", value: "joe" } ]; formdata lists and phase actions you can use the following functions in phase actions for formdata lists: formdata.add formdata.delete formdata.verify formdata.verifynot for an example, see the tps formdata unittest: http://hg.mozilla.org/services/tps/f...st_formdata.js notes note 1, tps supports the delete action for formdata, but sync currently does not correctly sync deleted form data, see bug 564296.

TPS Tests
steps get the source code clone mozilla-central (choose your flavor): hg clone hg.mozilla.org/mozilla-central or git clone github.com/mozilla/gecko-dev cd into the tps folder cd testing/tps create the environment i suggest the path to be outside of the mc source tree python create_venv.py --username=%email% --password=%password% %path% note: if you are updating the tps environment and want to keep your existing config (eg, th...

An Overview of XPCOM
« previousnext » copyright (c) 2003 by doug turner and ian oeschger.

Building the WebLock UI
« previousnext » copyright (c) 2003 by doug turner and ian oeschger.

Component Internals
« previousnext » copyright (c) 2003 by doug turner and ian oeschger.

Creating the Component Code
« previousnext » copyright (c) 2003 by doug turner and ian oeschger.

Finishing the Component
« previousnext » copyright (c) 2003 by doug turner and ian oeschger.

Packaging WebLock
« previousnext » copyright (c) 2003 by doug turner and ian oeschger.

Preface
next » copyright (c) 2003 by doug turner and ian oeschger.

Resources
current module owners xpinstall xul xpcom resources the xpcom project page xulplanet's online xpcom reference information on xpconnect and scriptable components the smart pointer guide xpidl xpidl compiler reference general development resources the world wide web consortium url specification at the w3 gnu make « previous copyright (c) 2003 by doug turner and ian oeschger.

Setting up the Gecko SDK
akefile $(cxx) -c $(cppflags) $(cxxflags) $(gecko_config_include) $(gecko_defines) $(gecko_includes) $< $(module).so: $(xpidlsrcs:%.idl=%.h) $(xpidlsrcs:%.idl=%.xpt) $(cppsrcs:%.cpp=%.o) $(cxx) -o $@ -wl,-soname=$(module).so $(cppsrcs:%.cpp=%.o) $(gecko_ldflags) chmod +x $@ build: $(module).so clean: rm $(module).so « previousnext » copyright (c) 2003 by doug turner and ian oeschger.

Starting WebLock
« previousnext » copyright (c) 2003 by doug turner and ian oeschger.

Using XPCOM Components
« previousnext » copyright (c) 2003 by doug turner and ian oeschger.

Using XPCOM Utilities to Make Things Easier
« previousnext » copyright (c) 2003 by doug turner and ian oeschger.

Creating XPCOM components
tting up the gecko sdk downloading and setting the sdk building a microsoft visual cpp project creating a new project adding the gecko sdk to the project settings building a windows project a makefile for unix appendix b - resources weblock resources gecko resources xpcom resources general development resources next » copyright (c) 2003 by doug turner and ian oeschger.

PyXPCOM
other resources pythonext - extension that provides pyxpcom samples - demo applications using pyxpcom community python-xpcom bindings mailing list (activestate) #pyxpcom on irc.mozilla.org source code the pyxpcom code is available here: http://hg.mozilla.org/pyxpcom/ to build pyxpcom, see building pyxpcom.

Creating a gloda message query
you can find the file, which includes doxygen markup of sorts, here: https://hg.mozilla.org/comm-central/file/tip/mailnews/db/gloda/modules/gloda.js components.utils.import("resource:///modules/gloda/public.js"); create the query let query = gloda.newquery(gloda.noun_message); add constraints to the query each constraint function takes one or more arguments which are "or"ed together.

Using COM from js-ctypes
lo firefox!'; let aflags = spf_default; primative_hr = spvoice.speak(spvoiceptr, atext, aflags, 0); checkhresult(primative_hr, "cocreateinstance"); } catch (ex) { console.error('ex occured:', ex); } finally { if (spvoice) { spvoice.release(spvoiceptr); } couninitialize(); } } main(); lib.close(); other examples shgetpropertystoreforwindow - this examples shows that coinit is not needed, some winapi functions return the interface.

BluetoothDevice - Web APIs
bluetoothdevice.connectgatt() a promise that resolves to an instance of bluetoothgattremoteserver.

BluetoothRemoteGATTDescriptor - Web APIs
interface interface bluetoothremotegattdescriptor { readonly attribute bluetoothgattcharacteristic characteristic; readonly attribute uuid uuid; readonly attribute arraybuffer?

Document.cookie - Web APIs
examples example #1: simple usage document.cookie = "name=oeschger"; document.cookie = "favorite_food=tripe"; function alertcookie() { alert(document.cookie); } <button onclick="alertcookie()">show cookies</button> example #2: get a sample cookie named test2 document.cookie = "test1=hello"; document.cookie = "test2=world"; const cookievalue = document.cookie .split('; ') .find(row => row.startswith('test2')) .split('=')[1]; function alertcooki...

Document Object Model (DOM) - Web APIs
t svgfontfacenameelement svgfontfacesrcelement svgfontfaceurielement svgforeignobjectelement svggelement svggeometryelement svgglyphelement svgglyphrefelement svggradientelement svggraphicselement svghatchelement svghatchpathelement svghkernelement svgimageelement svglineargradientelement svglineelement svgmarkerelement svgmaskelement svgmeshelement svgmeshgradientelement svgmeshpatchelement svgmeshrowelement svgmetadataelement svgmissingglyphelement svgmpathelement svgpathelement svgpatternelement svgpolylineelement svgpolygonelement svgradialgradientelement svgrectelement svgscriptelement svgsetelement svgsolidcolorelement svgstopelement svgstyleelement svgsvgelement svgswitchelement svgsymbolelement svgtextcontentelem...

Permissions.query() - Web APIs
example navigator.permissions.query({name:'geolocation'}).then(function(result) { if (result.state == 'granted') { showlocalnewswithgeolocation(); } else if (result.state == 'prompt') { showbuttontoenablelocalnews(); } // don't do anything if the permission was denied.

Permissions - Web APIs
example navigator.permissions.query({name:'geolocation'}).then(function(result) { if (result.state === 'granted') { showlocalnewswithgeolocation(); } else if (result.state === 'prompt') { showbuttontoenablelocalnews(); } // don't do anything if the permission was denied.

PublicKeyCredentialRequestOptions.extensions - Web APIs
txauthgeneric an object with two properties: contenttype (usvstring) content (arraybuffer) generic transaction authorization.

SpeechRecognition() - Web APIs
cyan | fuchsia | ghostwhite | gold | goldenrod | gray | green | indigo | ivory | khaki | lavender | lime | linen | magenta | maroon | moccasin | navy | olive | orange | orchid | peru | pink | plum | purple | red | salmon | sienna | silver | snow | tan | teal | thistle | tomato | turquoise | violet | white | yellow ;' var recognition = new speechrecognition(); var speechrecognitionlist = new speechgrammarlist(); speechrecognitionlist.addfromstring(grammar, 1); recognition.grammars = speechrecognitionlist; //recognition.continuous = false; recognition.lang = 'en-us'; recognition.interimresults = false; recognition.maxalternatives = 1; ...

SpeechRecognition.abort() - Web APIs
cyan | fuchsia | ghostwhite | gold | goldenrod | gray | green | indigo | ivory | khaki | lavender | lime | linen | magenta | maroon | moccasin | navy | olive | orange | orchid | peru | pink | plum | purple | red | salmon | sienna | silver | snow | tan | teal | thistle | tomato | turquoise | violet | white | yellow ;' var recognition = new speechrecognition(); var speechrecognitionlist = new speechgrammarlist(); speechrecognitionlist.addfromstring(grammar, 1); recognition.grammars = speechrecognitionlist; var diagnostic = document.queryselector('.output'); var bg = document.queryselector('html'); document.body.onclick = function() { recognition.start(); console.log('ready to receive a color command.'); } abortbtn.onclick = function() { recognition.abort(); console.log('speech reco...

SpeechRecognition.continuous - Web APIs
cyan | fuchsia | ghostwhite | gold | goldenrod | gray | green | indigo | ivory | khaki | lavender | lime | linen | magenta | maroon | moccasin | navy | olive | orange | orchid | peru | pink | plum | purple | red | salmon | sienna | silver | snow | tan | teal | thistle | tomato | turquoise | violet | white | yellow ;' var recognition = new speechrecognition(); var speechrecognitionlist = new speechgrammarlist(); speechrecognitionlist.addfromstring(grammar, 1); recognition.grammars = speechrecognitionlist; recognition.continuous = false; recognition.lang = 'en-us'; recognition.interimresults = false; recognition.maxalternatives = 1; ...

SpeechRecognition.interimResults - Web APIs
cyan | fuchsia | ghostwhite | gold | goldenrod | gray | green | indigo | ivory | khaki | lavender | lime | linen | magenta | maroon | moccasin | navy | olive | orange | orchid | peru | pink | plum | purple | red | salmon | sienna | silver | snow | tan | teal | thistle | tomato | turquoise | violet | white | yellow ;' var recognition = new speechrecognition(); var speechrecognitionlist = new speechgrammarlist(); speechrecognitionlist.addfromstring(grammar, 1); recognition.grammars = speechrecognitionlist; //recognition.continuous = false; recognition.lang = 'en-us'; recognition.interimresults = false; recognition.maxalternatives = 1; ...

SpeechRecognition.lang - Web APIs
cyan | fuchsia | ghostwhite | gold | goldenrod | gray | green | indigo | ivory | khaki | lavender | lime | linen | magenta | maroon | moccasin | navy | olive | orange | orchid | peru | pink | plum | purple | red | salmon | sienna | silver | snow | tan | teal | thistle | tomato | turquoise | violet | white | yellow ;' var recognition = new speechrecognition(); var speechrecognitionlist = new speechgrammarlist(); speechrecognitionlist.addfromstring(grammar, 1); recognition.grammars = speechrecognitionlist; //recognition.continuous = false; recognition.lang = 'en-us'; recognition.interimresults = false; recognition.maxalternatives = 1; ...

SpeechRecognition.maxAlternatives - Web APIs
cyan | fuchsia | ghostwhite | gold | goldenrod | gray | green | indigo | ivory | khaki | lavender | lime | linen | magenta | maroon | moccasin | navy | olive | orange | orchid | peru | pink | plum | purple | red | salmon | sienna | silver | snow | tan | teal | thistle | tomato | turquoise | violet | white | yellow ;' var recognition = new speechrecognition(); var speechrecognitionlist = new speechgrammarlist(); speechrecognitionlist.addfromstring(grammar, 1); recognition.grammars = speechrecognitionlist; //recognition.continuous = false; recognition.lang = 'en-us'; recognition.interimresults = false; recognition.maxalternatives = 1; ...

SpeechRecognition.start() - Web APIs
cyan | fuchsia | ghostwhite | gold | goldenrod | gray | green | indigo | ivory | khaki | lavender | lime | linen | magenta | maroon | moccasin | navy | olive | orange | orchid | peru | pink | plum | purple | red | salmon | sienna | silver | snow | tan | teal | thistle | tomato | turquoise | violet | white | yellow ;' var recognition = new speechrecognition(); var speechrecognitionlist = new speechgrammarlist(); speechrecognitionlist.addfromstring(grammar, 1); recognition.grammars = speechrecognitionlist; var diagnostic = document.queryselector('.output'); var bg = document.queryselector('html'); document.body.onclick = function() { recognition.start(); console.log('ready to receive a color command.'); } abortbtn.onclick = function() { recognition.abort(); console.log('speech reco...

SpeechRecognition.stop() - Web APIs
cyan | fuchsia | ghostwhite | gold | goldenrod | gray | green | indigo | ivory | khaki | lavender | lime | linen | magenta | maroon | moccasin | navy | olive | orange | orchid | peru | pink | plum | purple | red | salmon | sienna | silver | snow | tan | teal | thistle | tomato | turquoise | violet | white | yellow ;' var recognition = new speechrecognition(); var speechrecognitionlist = new speechgrammarlist(); speechrecognitionlist.addfromstring(grammar, 1); recognition.grammars = speechrecognitionlist; var diagnostic = document.queryselector('.output'); var bg = document.queryselector('html'); document.body.onclick = function() { recognition.start(); console.log('ready to receive a color command.'); } abortbtn.onclick = function() { recognition.abort(); console.log('speech reco...

Web APIs
ment svgviewelement svgzoomandpan screen screenorientation scriptprocessornode scrolltooptions securitypolicyviolationevent selection sensor sensorerrorevent serviceworker serviceworkercontainer serviceworkerglobalscope serviceworkermessageevent serviceworkerregistration serviceworkerstate shadowroot sharedworker sharedworkerglobalscope slottable sourcebuffer sourcebufferlist speechgrammar speechgrammarlist speechrecognition speechrecognitionalternative speechrecognitionerror speechrecognitionerrorevent speechrecognitionevent speechrecognitionresult speechrecognitionresultlist speechsynthesis speechsynthesiserrorevent speechsynthesisevent speechsynthesisutterance speechsynthesisvoice staticrange stereopannernode storage storageestimate storageevent s...

font-variation-settings - CSS: Cascading Style Sheets
syntax /* use the default settings */ font-variation-settings: normal; /* set values for opentype axis names */ font-variation-settings: "xhgt" 0.7; values normal text is laid out using default settings.

font-variation-settings - CSS: Cascading Style Sheets
syntax /* use the default settings */ font-variation-settings: normal; /* set values for variable font axis names */ font-variation-settings: "xhgt" 0.7; /* global values */ font-variation-settings: inherit; font-variation-settings: initial; font-variation-settings: unset; values this property's value can take one of two forms: normal text is laid out using default settings.

grid - CSS: Cascading Style Sheets
olumns: refer to corresponding dimension of the content areacomputed valueas each of the properties of the shorthand:grid-template-rows: as specified, but with relative lengths converted into absolute lengthsgrid-template-columns: as specified, but with relative lengths converted into absolute lengthsgrid-template-areas: as specifiedgrid-auto-rows: the percentage as specified or the absolute lengthgrid-auto-columns: the percentage as specified or the absolute lengthgrid-auto-flow: as specifiedgrid-column-gap: the percentage as specified or the absolute lengthgrid-row-gap: the percentage as specified or the absolute lengthcolumn-gap: as specified, with <length>s made absolute, and normal computing to zero except on multi-column elementsrow-gap: as specified, with <length>s made absolute, and ...

Block-level elements - HTML: Hypertext Markup Language
<hgroup> groups header information.

<h1>–<h6>: The HTML Section Heading elements - HTML: Hypertext Markup Language
permitted parents any element that accepts flow content; don't use a heading element as a child of the <hgroup> element — it is now deprecated.

<address>: The Contact Address element - HTML: Hypertext Markup Language
permitted content flow content, but with no nested <address> element, no heading content (<hgroup>, <h1>, <h2>, <h3>, <h4>, <h5>, <h6>), no sectioning content (<article>, <aside>, <section>, <nav>), and no <header> or <footer> element.

<keygen> - HTML: Hypertext Markup Language
p server: commonname=john+doe&email=doe@foo.com&org=foobar+computing+corp.& orgunit=bureau+of+bureaucracy&locality=anytown&state=california&country=us& key=mihfmhewxdanbgkqhkig9w0baqefaanladbiakeanx0tiljromuue%2bptwbre6xfv%0awtkqbsshxk5zhcuwcwyvcniq9b82qhjdoacdd34rqfcaind46fxkqunb0mvkzqid%0aaqabfhfnb3ppbgxhsxnneuzyawvuzdanbgkqhkig9w0baqqfaanbaakv2eex2n%2fs%0ar%2f7ijnrowlszsmttiqteb%2badwhgj9u1xruroilq%2fo2cuqxifzcnzkyakwp4dubqw%0ai0%2f%2frgbvmco%3d specifications specification status comment html5the definition of 'the <keygen> element' in that specification.

HTML elements reference - HTML: Hypertext Markup Language
<hgroup> the html <hgroup> element represents a multi-level heading for a section of a document.

HTML documentation index - HTML: Hypertext Markup Language
110 <hgroup> element, experimental, html, html sections, html5, reference, web the html <hgroup> element represents a multi-level heading for a section of a document.

Public class fields - JavaScript
class classwithgetset { #msg = 'hello world' get msg() { return this.#msg } set msg(x) { this.#msg = `hello ${x}` } } const instance = new classwithgetset() console.log(instance.msg) // expected output: "hello worl​d" instance.msg = 'cake' console.log(instance.msg) // expected output: "hello cake" specifications specification public and private instance fieldsthe de...

SyntaxError: missing variable name - JavaScript
var ohgodwhy = "foo"; reserved keywords can't be variable names there are a few variable names that are reserved keywords.

Intl.Locale.prototype.numberingSystem - JavaScript
mongolian digits mroo mro digits mtei meetei mayek digits mymr myanmar digits mymrshan myanmar shan digits mymrtlng myanmar tai laing digits native native digits newa newa digits nkoo n'ko digits olck ol chiki digits orya oriya digits osma osmanya digits rohg hanifi rohingya digits roman roman upper case numerals — algorithmic romanlow roman lowercase numerals — algorithmic saur saurashtra digits shrd sharada digits sind khudawadi digits sinh sinhala lith digits sora sora_sompeng digits sund sundanese digits takr takri digits tal...

Intl.NumberFormat() constructor - JavaScript
bext", "bali", "beng", "bhks", "brah", "cakm", "cham", "deva", "diak", "fullwide", "gong", "gonm", "gujr", "guru", "hanidec", "hmng", "hmnp", "java", "kali", "khmr", "knda", "lana", "lanatham", "laoo", "latn", "lepc", "limb", "mathbold", "mathdbl", "mathmono", "mathsanb", "mathsans", "mlym", "modi", "mong", "mroo", "mtei", "mymr", "mymrshan", "mymrtlng", "newa", "nkoo", "olck", "orya", "osma", "rohg", "saur", "segment", "shrd", "sind", "sinh", "sora", "sund", "takr", "talu", "tamldec", "telu", "thai", "tibt", "tirh", "vaii", "wara", "wcho".

String.prototype.split() - JavaScript
reversing a string using split() this is not a robust way to reverse a string: const str = 'asdfghjkl' const strreverse = str.split('').reverse().join('') // 'lkjhgfdsa' // split() returns an array on which reverse() and join() can be applied it doesn't work if the string contains grapheme clusters, even when using a unicode-aware split.

SVG 2 support in Mozilla - SVG: Scalable Vector Graphics
olors implementation status unknown color-profile removed implementation status unknown <color-profile> removed implementation status unknown paint servers change notes <solidcolor> (renamed solidcolor) not implemented (bug 1177032) fr attribute for <radialgradient> not implemented (bug 1240275) <mesh> (renamed meshgradient) not implemented (bug 1238882) <meshrow> (renamed meshrow) not implemented (bug 1238882) <meshpatch> (renamed meshpatch) not implemented (bug 1238882) <hatch> not implemented (bug 1239147) <hatchpath> (renamed hatchpath) not implemented (bug 1239147) display behavior of paint server elements defined by ua style sheet not implem...